ID: 1138280187

View in Genome Browser
Species Human (GRCh38)
Location 16:55767226-55767248
Sequence CTCACGACATTGTAGTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138280187_1138280193 25 Left 1138280187 16:55767226-55767248 CCTACCCACTACAATGTCGTGAG No data
Right 1138280193 16:55767274-55767296 GGCTTGAACCTCCCAGCCCAAGG No data
1138280187_1138280190 4 Left 1138280187 16:55767226-55767248 CCTACCCACTACAATGTCGTGAG No data
Right 1138280190 16:55767253-55767275 TAAATATCAAGTCCATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138280187 Original CRISPR CTCACGACATTGTAGTGGGT AGG (reversed) Intergenic
No off target data available for this crispr