ID: 1138282527

View in Genome Browser
Species Human (GRCh38)
Location 16:55783016-55783038
Sequence CAGAAAAAGGAGAAGGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138282523_1138282527 17 Left 1138282523 16:55782976-55782998 CCGTGCATTTGGTGTTGAAAAAT No data
Right 1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG No data
1138282524_1138282527 -6 Left 1138282524 16:55782999-55783021 CCACATAATAGCACATTCAGAAA No data
Right 1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138282527 Original CRISPR CAGAAAAAGGAGAAGGAAAT TGG Intergenic
No off target data available for this crispr