ID: 1138283469

View in Genome Browser
Species Human (GRCh38)
Location 16:55790281-55790303
Sequence TTTAAAACAGCTGCCGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138283469_1138283472 -8 Left 1138283469 16:55790281-55790303 CCTGCACCGGCAGCTGTTTTAAA No data
Right 1138283472 16:55790296-55790318 GTTTTAAATGAATTGACCCAGGG No data
1138283469_1138283471 -9 Left 1138283469 16:55790281-55790303 CCTGCACCGGCAGCTGTTTTAAA No data
Right 1138283471 16:55790295-55790317 TGTTTTAAATGAATTGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138283469 Original CRISPR TTTAAAACAGCTGCCGGTGC AGG (reversed) Intergenic
No off target data available for this crispr