ID: 1138285532

View in Genome Browser
Species Human (GRCh38)
Location 16:55806706-55806728
Sequence TTTAAAACAGCTGCCGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138285530_1138285532 -9 Left 1138285530 16:55806692-55806714 CCTGGGTCAATTCATTTAAAACA 0: 2
1: 0
2: 2
3: 23
4: 357
Right 1138285532 16:55806706-55806728 TTTAAAACAGCTGCCGGTGCAGG 0: 2
1: 0
2: 0
3: 9
4: 88
1138285529_1138285532 -8 Left 1138285529 16:55806691-55806713 CCCTGGGTCAATTCATTTAAAAC 0: 2
1: 0
2: 4
3: 16
4: 171
Right 1138285532 16:55806706-55806728 TTTAAAACAGCTGCCGGTGCAGG 0: 2
1: 0
2: 0
3: 9
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138285532 Original CRISPR TTTAAAACAGCTGCCGGTGC AGG Intronic
906178738 1:43799801-43799823 GTCAAAACAGCTGCTGGTACAGG - Intronic
906305807 1:44718440-44718462 TTTCAGGCAGCAGCCGGTGCAGG + Intronic
916778891 1:168001145-168001167 TTTAAAACAGCTGGTTGTGGTGG + Intronic
919637569 1:200017717-200017739 TTTAAAACAGTTACCGTGGCTGG - Intergenic
922651411 1:227342239-227342261 ATCGAATCAGCTGCCGGTGCAGG - Intergenic
923546729 1:234928769-234928791 TGTAAATCAGCTGCCGGGGCAGG + Intergenic
1062854309 10:772172-772194 TTTAAAACAGCCGCCTGGCCGGG + Intergenic
1063194381 10:3727648-3727670 GTTCAAACAGCAGCCGGAGCTGG + Intergenic
1076040593 10:127244770-127244792 TTTTACTCAGCTGCTGGTGCTGG + Intronic
1076507983 10:130990841-130990863 TTTAAAAGAGCTGCCAATTCGGG + Intergenic
1078136809 11:8658485-8658507 TTTAAATGAGCTGCCGGATCGGG - Intronic
1080461635 11:32459787-32459809 TTTAAAGCATCTGCAGGTGCCGG + Intergenic
1087270037 11:96101686-96101708 TGAAAAAGAGCTGCCGGTGATGG - Intronic
1087337665 11:96865029-96865051 TTTAAAGCAGCTCTCGGTACTGG + Intergenic
1089065777 11:115660737-115660759 TTCAAAGCATCTGCCAGTGCTGG - Intergenic
1090535044 11:127631804-127631826 ATTAAAACAGCTTCCAGTGGTGG + Intergenic
1091318273 11:134631561-134631583 TTTAAAACAGCTGTGGAGGCTGG + Intergenic
1102423979 12:112826101-112826123 TTTAAAACAGCTCCCACAGCGGG - Intronic
1103930583 12:124448731-124448753 TTTCACACATCTGCTGGTGCTGG - Intronic
1111075166 13:83225659-83225681 TTTTAAACAGATGCCTTTGCTGG - Intergenic
1112750966 13:102583034-102583056 TTTAAAACCTCTGCCGGAGCAGG + Intergenic
1118154029 14:63221030-63221052 TCTAAAACAGCTGCTCGGGCTGG + Intronic
1123414479 15:20085074-20085096 TATAAAACAGGTGCTGGGGCCGG - Intergenic
1123523821 15:21092185-21092207 TATAAAACAGGTGCTGGGGCCGG - Intergenic
1124831415 15:33153410-33153432 TTGCCAAGAGCTGCCGGTGCTGG + Exonic
1126847177 15:52771751-52771773 TTTAAAATATCTGCCTGTGATGG - Intronic
1131716858 15:95120999-95121021 CTTAAAACAGCTGCCTGAACAGG - Intergenic
1133853993 16:9532500-9532522 TTTAAAATAGATGCTGGTGGTGG - Intergenic
1135404199 16:22186567-22186589 TTTAAATCAGCAGCCCTTGCTGG - Intronic
1138154242 16:54687769-54687791 TTTAAAACAGCTCCCAGAGGTGG + Intergenic
1138277486 16:55746494-55746516 TTCAAAATAACTGCCAGTGCAGG - Intergenic
1138283469 16:55790281-55790303 TTTAAAACAGCTGCCGGTGCAGG - Intergenic
1138285532 16:55806706-55806728 TTTAAAACAGCTGCCGGTGCAGG + Intronic
1141604480 16:85145050-85145072 GTTAACACAGTTGCAGGTGCAGG + Intergenic
1141979846 16:87543313-87543335 CTTTAAGCAGCTGCTGGTGCTGG + Intergenic
1148864105 17:50619679-50619701 TGTCAAACAGCTGCCTGTCCTGG - Exonic
1153372492 18:4334762-4334784 CTTAAAACAGATGCAGGTGGAGG - Intronic
1153926459 18:9839268-9839290 TTTAAATCAGCTGCTGGTGATGG - Intronic
1157599965 18:48887825-48887847 TCTAAAACATCTGCCCTTGCCGG + Intergenic
1159037428 18:63291054-63291076 TGGAAAACAGCTGTGGGTGCCGG - Intronic
1161242977 19:3233132-3233154 TTTAAAAAAGCTGCACGTGGTGG + Intronic
1161597254 19:5156839-5156861 TCTAAAGCAGCTGCTGGGGCTGG - Intergenic
1161728469 19:5944561-5944583 TTTCTCACAGCTGCCTGTGCTGG - Intronic
1162637918 19:11984882-11984904 TTTAGAACAGCTGCTGCTGCAGG + Intergenic
1163752949 19:19089229-19089251 TTTAAAACAGATTCCAGGGCTGG + Intronic
926125942 2:10271981-10272003 TTTAAACCAGCCGCAAGTGCAGG - Intergenic
931356755 2:61543791-61543813 TTTAAAACATCTCCCAGGGCTGG - Intergenic
933893881 2:86793325-86793347 TTTGAAAAAGCTGCAGGTACTGG - Intronic
941003386 2:160223448-160223470 TTTAAATCAGCAGCCATTGCAGG + Intronic
942091503 2:172495860-172495882 TTTAAAACAGCTGACAGTAGGGG - Intronic
944388442 2:199190594-199190616 TTTAAGAAAGCTGTCAGTGCTGG - Intergenic
945593649 2:211765837-211765859 TTTAAAACATATGCCAGTGAAGG - Intronic
948453723 2:238094354-238094376 TTTCAAACAGTTGCTGGTGGTGG + Intronic
948552961 2:238786782-238786804 TTTAAAACAGCATCCGATCCTGG - Intergenic
1174442842 20:50569814-50569836 TTTAGACCATCTGCCTGTGCAGG + Intronic
1175291688 20:57880250-57880272 TAAAACACAGCTGTCGGTGCCGG - Intergenic
1178415719 21:32403495-32403517 TTTAAAACTGCTGCCGATCAAGG + Intergenic
1182304399 22:29357980-29358002 TTAAAAACAGCTGCCTGGGCCGG - Intronic
1182545633 22:31074491-31074513 TATAAAACAGGTGCTGGGGCTGG + Intronic
1184868973 22:47221589-47221611 TTTTTAACAGCTTCCTGTGCTGG + Intergenic
950615756 3:14156763-14156785 TTTAACACATCTGCTGGGGCTGG - Intronic
951799047 3:26574848-26574870 TCAAAAACAGTTGCAGGTGCAGG - Intergenic
954772733 3:52987335-52987357 TTTTATACAACTGCCAGTGCAGG + Intronic
956381621 3:68670344-68670366 CTTAAAACAACTTCCAGTGCTGG - Intergenic
956603412 3:71047503-71047525 TTAAAAGCTTCTGCCGGTGCAGG - Intronic
965374455 3:167905652-167905674 TGTAAAACAGCTGCAGGTGTTGG + Intergenic
967222525 3:187259523-187259545 TTTAAAAAAGCTCCTGGTGAAGG + Intronic
967700912 3:192591382-192591404 CTTAAAACAGCTGCCAGTGAAGG + Intronic
969806342 4:9611930-9611952 TTTAAAACAGTGGCAGGTGGAGG + Intergenic
972318699 4:37952030-37952052 TTTGAAAGAGCTGCCGGAGAAGG + Intronic
977841116 4:101706429-101706451 TTTAAAACAGCATCAGGTGGAGG + Intronic
993585046 5:89713829-89713851 AGTATAACAGCTGCCAGTGCAGG + Intergenic
993660857 5:90632878-90632900 TTCAAAACAGCTGTAGGTTCTGG + Intronic
996514773 5:124357647-124357669 TTCAAAACAGCTGACGCTGTAGG + Intergenic
1001782764 5:174384622-174384644 TTTATAACAGTTGCCGGAACAGG - Intergenic
1005192846 6:23245661-23245683 TTCAAAACAGATGCTGGTGGAGG - Intergenic
1010450982 6:76002674-76002696 TAGAAAAGGGCTGCCGGTGCTGG + Intronic
1017602610 6:156100192-156100214 TGTAAAACACCTGCCCATGCTGG + Intergenic
1017741443 6:157410075-157410097 CTTAGAACAGCTGCCAGCGCGGG - Intronic
1020419707 7:7987845-7987867 TTTAAAAGAGCTGGGGTTGCAGG + Intronic
1023350756 7:39318278-39318300 TTTAAACAAGCTTCTGGTGCAGG - Intronic
1025819527 7:64949117-64949139 TCTAAATCAGCTGCTGGTTCTGG - Intergenic
1031799705 7:126226612-126226634 TTTAAAACAGCTGCTGTTTCTGG + Intergenic
1032507230 7:132444840-132444862 TTTAACACACCTGACAGTGCTGG - Intronic
1033322155 7:140349631-140349653 TTTAAAACAGCTTCCCTGGCAGG + Intronic
1036463912 8:8978662-8978684 TTTAAATCAGCTGAGGGGGCGGG - Intergenic
1036626704 8:10478627-10478649 TTTAAAACAGCTCCCAGGCCAGG + Intergenic
1037702509 8:21287791-21287813 TTTAAAAGAGTTGCAGGTCCTGG + Intergenic
1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG + Exonic
1047906840 8:129481566-129481588 TGTAAAACAGCTGCCTTTCCTGG + Intergenic
1048491602 8:134898973-134898995 TAAAAATCAGCTGCCTGTGCGGG - Intergenic
1057945050 9:99319187-99319209 TTAAAAACAGCTGCAGAAGCAGG + Intergenic
1059455162 9:114395716-114395738 TTAAAGACAGCTGCAGGTGAAGG - Intergenic
1061523148 9:131134097-131134119 TTAAAAACAGCTGGCTGTGTTGG - Intronic
1061541843 9:131281655-131281677 ATTGAAACCGCTGCCTGTGCTGG + Intergenic
1062560752 9:137140843-137140865 CTTCAAACAGCTGCAGCTGCAGG + Intronic
1062743913 9:138199082-138199104 TTTAAACCAGCTGGCTGTGGCGG - Intergenic
1199746083 X:150772603-150772625 TTTAAAACAGGTCCCGCTGGAGG + Intronic
1199968893 X:152844099-152844121 TGTAACACAGCTTCCTGTGCAGG - Intronic