ID: 1138285826

View in Genome Browser
Species Human (GRCh38)
Location 16:55809620-55809642
Sequence GTGCAGTAGCATGCAAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138285826 Original CRISPR GTGCAGTAGCATGCAAGCAC AGG (reversed) Intronic
902572682 1:17356750-17356772 AAGCAGTAGCATGCAAGTAGGGG + Intronic
909128857 1:71709820-71709842 TAGCAGTACCCTGCAAGCACAGG + Intronic
910843835 1:91586644-91586666 ATGCAGTAGGCTGCAAGCAATGG - Intergenic
912457595 1:109808294-109808316 GTACAGTGGCAGGCAAGCATGGG + Intergenic
915971314 1:160357100-160357122 GTGCAGTAGAACGCACACACCGG - Exonic
917161874 1:172066435-172066457 GTGTGGTAGCATGCTAGCTCAGG + Intronic
922730423 1:227946497-227946519 GTGCAGTGGCGTGCCAGCCCAGG + Intronic
1062910827 10:1210912-1210934 CTGCAGCAGCCTTCAAGCACCGG - Intronic
1063019614 10:2114627-2114649 CTGCCGTAGCATGCAGCCACTGG - Intergenic
1066477403 10:35761291-35761313 GTCAAGTAAAATGCAAGCACAGG + Intergenic
1067337673 10:45378196-45378218 GTGGAGTGGCATGGAAGGACAGG - Intronic
1070401269 10:76055635-76055657 GTACATGAGCAAGCAAGCACAGG + Intronic
1070402880 10:76068850-76068872 ATGCAGTAGCACGCAAGTAATGG + Intronic
1075253741 10:120907474-120907496 CAGCAGGACCATGCAAGCACTGG - Intronic
1075671092 10:124264629-124264651 GTGCTGTAGCAGGCTGGCACAGG + Intergenic
1078339208 11:10487005-10487027 GGGCAGTAGCAGGCCAGCTCTGG - Intronic
1085506452 11:77063583-77063605 TTACAGTGGCATGCAAGCAGAGG + Intergenic
1086115935 11:83250199-83250221 GTACAGTAGTATGCAATCATAGG - Intronic
1087008482 11:93491767-93491789 GTGCACCAGCATGCCAGCATGGG - Intronic
1087192968 11:95275227-95275249 TTGCAGGAGTAAGCAAGCACAGG + Intergenic
1089378207 11:118010102-118010124 ATGCAGTACCATGCAAGAAAAGG + Intergenic
1091776675 12:3189235-3189257 GGGCAGGTGCATGCAGGCACAGG + Intronic
1091925160 12:4340992-4341014 GAGCAATAACCTGCAAGCACAGG + Intronic
1093498480 12:19783654-19783676 CTGCTGTAGCATTCATGCACTGG - Intergenic
1093729361 12:22549956-22549978 GTGCAGTGGCAAGCAATCTCAGG + Intergenic
1107002318 13:35562754-35562776 GTGAAGAAGCAGACAAGCACAGG + Intronic
1108760549 13:53558038-53558060 GTGCAGAAGCAAGCTAGCTCTGG - Intergenic
1111484781 13:88882193-88882215 GAGCAATACCCTGCAAGCACAGG - Intergenic
1113476416 13:110585188-110585210 GTGCAGTAAAATGAAATCACTGG - Intergenic
1116269610 14:42744690-42744712 GAGCAATACCCTGCAAGCACAGG + Intergenic
1122492248 14:102126234-102126256 ATGCAAAAGCATGAAAGCACAGG + Intronic
1130082679 15:80747997-80748019 ATGCAGCAGCAGGAAAGCACTGG - Intronic
1130885871 15:88092088-88092110 GTGCAGCAGCACCAAAGCACAGG + Intronic
1131713881 15:95087425-95087447 CTGCAGTAGCATGGAAGTTCAGG - Intergenic
1138283105 16:55786981-55787003 GTGCAGGAACGTGCAAGCACAGG + Intergenic
1138285826 16:55809620-55809642 GTGCAGTAGCATGCAAGCACAGG - Intronic
1140883279 16:79218788-79218810 GTGCAGTAGCTTGGATGGACTGG - Intergenic
1142769357 17:2085528-2085550 GTGGAGTAGGATGGAGGCACCGG + Intronic
1144685105 17:17221033-17221055 GTGCACCAGCCTGGAAGCACTGG - Intronic
1152377515 17:79926489-79926511 GTGCAGATGCATGCAAGGACAGG - Intergenic
1152414526 17:80150636-80150658 GTGCAGCAGGAGGCAAGCAAGGG + Intergenic
1157959524 18:52136956-52136978 GTGCACTAACATAGAAGCACTGG - Intergenic
1158773077 18:60544767-60544789 GCGCAGTAGCATGCAACCATTGG - Intergenic
1168389219 19:55992686-55992708 GTGCAGGAGCAGCTAAGCACGGG + Intergenic
925971253 2:9108041-9108063 CTGCAGTAGCCTGCCAGCATGGG - Intergenic
927261999 2:21101374-21101396 GTGCTATAGCATGAAAGCAGAGG + Intergenic
935550672 2:104450363-104450385 GTAGAGTAGAATGCAAGCGCAGG + Intergenic
940467499 2:154050370-154050392 GTGATGTAGCATGAGAGCACAGG - Intronic
940721973 2:157292394-157292416 GAGCAATAGCATGCATGCACAGG + Intronic
940878411 2:158921850-158921872 GTGCATGAGCAAGCAAGCACAGG + Intergenic
941176461 2:162203353-162203375 ATGCAGTAGCAGCCAAGCAGTGG - Intronic
941566823 2:167118934-167118956 GTGCAGTGTCATGGAAGCCCAGG + Intronic
943022959 2:182597445-182597467 CTGCAATAGCCTGCAAGCGCTGG - Intergenic
943226592 2:185186135-185186157 GAGCAATACCATACAAGCACAGG - Intergenic
1172060207 20:32182234-32182256 GAGCAAGAGCAAGCAAGCACTGG + Intergenic
1172326076 20:34035878-34035900 GTGCAGAAATATGCAAGAACTGG + Intronic
1177014024 21:15761644-15761666 GTGCAGTGGCCTGCCAGCACTGG - Intronic
960713321 3:120552494-120552516 GTGCAGGAGCCTGGAAGCATTGG + Intergenic
963049182 3:141127187-141127209 GTGCAGCAGCAAGCCAGCAGTGG + Intronic
971558559 4:28044695-28044717 GAGCAGTATCCTACAAGCACAGG - Intergenic
977750900 4:100608755-100608777 GGGCTGAAGAATGCAAGCACAGG - Intronic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
985184215 4:187297938-187297960 GTCCAGTCACATGAAAGCACAGG + Intergenic
988940669 5:36142566-36142588 TTGCAGCAGCATGCTTGCACCGG + Exonic
991252023 5:64573457-64573479 GTACAGTAGCATCCAAGCCATGG - Intronic
995386748 5:111596911-111596933 GTGCATGAGCAAGCAAGCACAGG - Intergenic
995969493 5:117950732-117950754 TTACAGTAGAATGTAAGCACTGG + Intergenic
998923445 5:147096553-147096575 GTGCAGTTGCATGAGAGCAGTGG + Intergenic
1001702286 5:173715733-173715755 GGGCAGTACGATGCAAGCAGTGG - Intergenic
1003022725 6:2525461-2525483 TTGCAGTATCATGGAAGCAGTGG + Intergenic
1006249227 6:32766399-32766421 GTGCAGTTGAATGTAAACACAGG + Intergenic
1009243250 6:61204244-61204266 ATGCATGAGCATGCAAGCATGGG + Intergenic
1010377424 6:75187415-75187437 GTGCAGTTGCATGTATGCAAGGG - Intronic
1013528593 6:110998243-110998265 GTGCAGTGGCCTGCCAGCACTGG + Intronic
1017221490 6:151970664-151970686 GAGCAGAAGCTTTCAAGCACAGG - Intronic
1020680871 7:11234936-11234958 GAGCAGTGGCCTGCTAGCACTGG + Intergenic
1021828509 7:24578492-24578514 GTCCAGTGGAATGCAAGGACTGG + Intronic
1025068113 7:55874932-55874954 GTGCAGGAGCATGCAGTCCCAGG - Intergenic
1026524785 7:71144348-71144370 GTGCCATAGGATGCAAGCTCAGG + Intronic
1027457635 7:78413447-78413469 GTGAAGTAGAATGGAAGAACAGG + Intronic
1030756456 7:113292369-113292391 GTGCATGAGCGAGCAAGCACAGG - Intergenic
1033055418 7:138048169-138048191 ATGCCGTAGAATGCAAGTACTGG - Intronic
1037850164 8:22320913-22320935 GTGCAGTCTGCTGCAAGCACAGG + Intronic
1038913358 8:31992380-31992402 GTTCAGTATCAGGCAAGCAGAGG - Intronic
1046588118 8:116172845-116172867 GTGCAAAAGCAAGCAAGCTCTGG - Intergenic
1058893177 9:109378775-109378797 GTGCAGTAGGAGGCAAGCAGAGG + Exonic
1186096036 X:6103089-6103111 GAGCAGTAGAAAGCAACCACAGG - Intronic
1187216021 X:17277314-17277336 GTGCTGTTGAATGAAAGCACAGG + Intergenic
1197171458 X:123439190-123439212 TTGCACTAGCATGCAGGCAAAGG + Intronic
1197709293 X:129654439-129654461 GTGCAGTAGCAGCCACGCGCCGG - Intronic
1199438307 X:147839610-147839632 GTGGAGTAGCATCCAGGCAGAGG + Intergenic
1199465840 X:148135949-148135971 GTCCAGTGGCATTCAATCACTGG + Intergenic