ID: 1138286414

View in Genome Browser
Species Human (GRCh38)
Location 16:55813603-55813625
Sequence CAGAAAAAGGAGAAGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1795
Summary {0: 2, 1: 0, 2: 12, 3: 169, 4: 1612}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138286414_1138286418 17 Left 1138286414 16:55813603-55813625 CCAATTTCCTTCTCCTTTTTCTG 0: 2
1: 0
2: 12
3: 169
4: 1612
Right 1138286418 16:55813643-55813665 ATTTTTCAACACCAAATGCACGG 0: 2
1: 0
2: 0
3: 21
4: 287
1138286414_1138286417 -6 Left 1138286414 16:55813603-55813625 CCAATTTCCTTCTCCTTTTTCTG 0: 2
1: 0
2: 12
3: 169
4: 1612
Right 1138286417 16:55813620-55813642 TTTCTGAATGTGCTATTATGTGG 0: 2
1: 0
2: 2
3: 27
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138286414 Original CRISPR CAGAAAAAGGAGAAGGAAAT TGG (reversed) Intronic
900141481 1:1140991-1141013 CAGACAAAGGTGCGGGAAATGGG + Intergenic
901269662 1:7942175-7942197 AAGAATGAGGAGAAGGAAAAAGG + Intronic
901315698 1:8306408-8306430 CAGAAAAAAGAAAAGAAAAGAGG + Intergenic
901450532 1:9333928-9333950 CAAAAAAATGAGAAGGAATGTGG - Intronic
902185814 1:14724575-14724597 CACAAAACGGAGAAGGAACCAGG - Intronic
902323885 1:15685571-15685593 AAGAAAAAAGAGAAAGAAAATGG + Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
903030167 1:20458413-20458435 AAAAAAAAGAAGAAGGAAAGAGG - Intergenic
903130098 1:21273590-21273612 TAGAAATAGAAGGAGGAAATAGG + Intronic
903253744 1:22076799-22076821 AAGGGAAAGGAGAAGGAAAAAGG + Intronic
903273602 1:22207390-22207412 AAGAAATAGAAGAAGCAAATTGG - Intergenic
903331791 1:22600338-22600360 AGGAGAAAGGAGAAGGAAGTGGG + Intronic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903772149 1:25770717-25770739 CAGAGAGGGGAGAAGGAAAGTGG - Intronic
903803654 1:25988826-25988848 AAAAAAAAGGAAAAGAAAATGGG + Intronic
903869270 1:26420775-26420797 TAGAAAATGGAGAAGCAAAAGGG - Intronic
903875382 1:26470301-26470323 AAAAAAAAGAAGAAGGAAAATGG - Exonic
904030566 1:27531104-27531126 AAGAAAAAGAAAAAGGAAAGGGG + Intergenic
904210301 1:28882816-28882838 AAGAAAAAAGATAAGAAAATTGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904649012 1:31990225-31990247 AAGAAAAAAGAGAAGGATCTGGG - Intergenic
904874772 1:33645931-33645953 CAGACAAAACAGAAAGAAATGGG - Intronic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905334385 1:37234145-37234167 ACTAAAAAGGAGCAGGAAATTGG - Intergenic
905535430 1:38717876-38717898 AAGAACAAGGTGAAGGAAATGGG - Intergenic
905950710 1:41948280-41948302 TAGAATTAGGAGAAGGAAAAAGG + Intronic
905995209 1:42375554-42375576 AAGAAAGAAAAGAAGGAAATGGG - Intergenic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906583737 1:46957656-46957678 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906796423 1:48699787-48699809 GAGAAAAACCAGGAGGAAATGGG - Intronic
907037487 1:51229240-51229262 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
907123456 1:52028275-52028297 CAGAGACATGAGAAGGAAGTAGG - Intronic
907201909 1:52734716-52734738 AAGAAAAAGAAAAAGAAAATTGG - Intronic
907561730 1:55397056-55397078 AGGAAAGAGGAGAAGGAAAGAGG - Intergenic
907659745 1:56381055-56381077 TAGAAGAAGGAGAAAGGAATGGG + Intergenic
907771482 1:57469397-57469419 CAGAAAAAGGAGAAAAAAGTTGG + Intronic
907874361 1:58471508-58471530 CAGAAAAAGAAGAGGAAAAGTGG + Intronic
907990082 1:59572337-59572359 AAGAATAAGCAGAAGGAAATTGG + Intronic
908159410 1:61391894-61391916 CAGGAAAATGAGAAGCAATTAGG + Intronic
908600355 1:65732163-65732185 CAGAGAAAGGAGGAGCAAAAGGG - Intergenic
908664427 1:66474212-66474234 TAGAAAAAAGAGATAGAAATTGG - Intergenic
908828577 1:68157054-68157076 CAGAATTGGGAGAAGGACATGGG + Intronic
908984425 1:69999758-69999780 GAGAAAAAGCAGAAGAAATTTGG + Intronic
909055042 1:70810814-70810836 CAGAAACAGGTGGAGGCAATTGG + Intergenic
909091534 1:71232187-71232209 CTGAAGAAAGAGAAGAAAATGGG - Intergenic
909483964 1:76153811-76153833 GAGAAAAACGAGAAGGGAAGGGG - Intronic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
909686550 1:78355217-78355239 CAAAAAAAGGAGGAGGAGAAAGG - Intronic
910330247 1:86065184-86065206 AAAAAATAGGAAAAGGAAATAGG - Intronic
910457819 1:87416392-87416414 GAGAAAAAGTAAAATGAAATTGG - Intergenic
910662365 1:89687570-89687592 GAGTAAATGGAGAAGGAAGTGGG + Intronic
910801396 1:91150632-91150654 CAGAAAAAGAAGAACAAACTAGG - Intergenic
910804815 1:91179889-91179911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
911313388 1:96325725-96325747 CAGAAAAAGGAGAATGGATGGGG - Intergenic
911488934 1:98537970-98537992 GGGAAAAAAGAAAAGGAAATGGG - Intergenic
911513135 1:98832556-98832578 AGAAAAAAGGAGAAAGAAATAGG + Intergenic
911845330 1:102745646-102745668 CATCAAAAGGAGAAGGAGAGGGG - Intergenic
911953436 1:104206170-104206192 AAGAAAAAAAAGTAGGAAATGGG + Intergenic
911991741 1:104706897-104706919 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
912075286 1:105866831-105866853 GAGAATAAGGAGAAAGGAATAGG + Intergenic
912359148 1:109080435-109080457 AAGAAAAAGGGGAAAGAAGTTGG + Intergenic
912387547 1:109279512-109279534 CTAAAAAAAGAGAAAGAAATAGG + Intergenic
912390937 1:109302429-109302451 CAGAAAAAATAAAAGGACATAGG + Intronic
912393728 1:109323198-109323220 AAGAACAAGGAGAGGGAAAGTGG + Intronic
912771254 1:112465882-112465904 AATAAAAGGGAGAAGGAGATCGG + Intergenic
912920034 1:113857671-113857693 AAGAAAAAGGAGAGGGAAATTGG - Intronic
912969363 1:114266086-114266108 CAGGAAGAAGAGAAGGAAAAAGG + Intergenic
913529423 1:119723044-119723066 CTGAAATAGGAGAAAGAAAAGGG + Intronic
913561405 1:120024288-120024310 CACAAGAAGGTGAAGGAAAAGGG + Intronic
913636722 1:120769314-120769336 CACAAGAAGGTGAAGGAAAAGGG - Intergenic
914281991 1:146183697-146183719 CACAAGAAGGTGAAGGAAAGGGG + Intronic
914315089 1:146502866-146502888 GAGAAAAAGTAAAATGAAATTGG - Intergenic
914345417 1:146794581-146794603 GAGAAGAAGGAGAAGGACCTGGG + Intergenic
914413762 1:147457878-147457900 AACAAAAGGAAGAAGGAAATAGG + Intergenic
914499265 1:148230505-148230527 GAGAAAAAGTAAAATGAAATTGG + Intergenic
914543020 1:148634404-148634426 CACAAGAAGGTGAAGGAAAGGGG + Intronic
914623602 1:149436608-149436630 CACAAGAAGGTGAAGGAAAGGGG - Intergenic
914676567 1:149910939-149910961 GAGAAATAGGAGAAGACAATGGG + Exonic
914730695 1:150367504-150367526 AAGAAAAAAGAGAAGCAAAGTGG - Intronic
914787708 1:150849762-150849784 CAAAAAAATAAGAAGAAAATAGG + Intronic
914916318 1:151821407-151821429 GAGAAAAAGGAGAGAGAAAGAGG - Intronic
915007243 1:152650075-152650097 AAGAACAAGGAGATTGAAATGGG - Intergenic
915625485 1:157111729-157111751 GAGACAAAGAAGAAGGAAAGGGG + Intergenic
915755813 1:158258139-158258161 CTGAAAAATTAGAAGGAAAGGGG - Exonic
916149342 1:161771233-161771255 AAGAATAAAGAGAAGGAAAAAGG - Intronic
916267331 1:162903891-162903913 CAGAAGAAAGTGAAGGAACTGGG + Intergenic
916663016 1:166939584-166939606 AAGGAAAAGAAGAAGGAAAGTGG + Intronic
916871537 1:168919881-168919903 CAGGAAAAGAAGAAAGAAAATGG + Intergenic
916935644 1:169625385-169625407 CAGAAGAATGAGAAGAGAATAGG - Intronic
916954099 1:169813674-169813696 CAGAAAAAGGAGAAGGTTAGCGG + Intronic
917153603 1:171971190-171971212 GAGAAAAAACAAAAGGAAATAGG - Intronic
917610104 1:176680988-176681010 TAGGAAAAGGAAAAGCAAATGGG + Intronic
918021599 1:180698563-180698585 CACAAAAATGAGAAAGAAAATGG - Intronic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918188459 1:182148444-182148466 CAGTAATAGGAGAAGGAAGTAGG - Intergenic
918350682 1:183652725-183652747 CAGACAAAGCAAAAGGAAAAGGG - Intronic
918434836 1:184500716-184500738 CAGTTAAAGGAGAAGGAGCTGGG + Intronic
918628473 1:186686126-186686148 CAGAAAAAGGAGCAAAAAATAGG + Intergenic
918699884 1:187595577-187595599 CAGAAAAGAGAGAGAGAAATAGG - Intergenic
918702230 1:187619763-187619785 CAGAAGAAGGAGAAAGAACTTGG + Intergenic
918713873 1:187765283-187765305 CAGAAAAAGCAGAATGAAAAAGG - Intergenic
918803809 1:189011917-189011939 GAGAACAACGAGAAGTAAATTGG + Intergenic
919109898 1:193205806-193205828 AAGAAAAAAGTGAAGGAAATAGG + Intronic
919197046 1:194299347-194299369 TAGAAACAGAAGAAGGAAAGAGG - Intergenic
919303996 1:195806663-195806685 CAGACAAAAGAGAAGGCCATGGG + Intergenic
919381533 1:196867278-196867300 AAAAAAAAACAGAAGGAAATGGG - Intronic
919412698 1:197266105-197266127 CAGAAAAAGGATATGTATATAGG - Intergenic
919505648 1:198394842-198394864 CAGAAAGAGGAAAAACAAATAGG - Intergenic
919571460 1:199254204-199254226 CACAAGTAGGAGAATGAAATTGG - Intergenic
919696960 1:200587376-200587398 CAGAAAAAAAAGAAGAAAAAAGG + Intronic
919776812 1:201199586-201199608 CTGAAAAAGGAGCAGGAATGAGG - Intronic
920110891 1:203586347-203586369 CAGAAACGGGAGAAGTAAGTGGG - Intergenic
920431628 1:205922541-205922563 CAGAAAATGGAGAAGGGCCTTGG + Intronic
920618257 1:207516708-207516730 CAGAATAAAGATAATGAAATAGG - Intronic
920758816 1:208761907-208761929 AAGAAAAGGAGGAAGGAAATAGG - Intergenic
920881660 1:209886561-209886583 AAGAAAAAAGAGAAGGGAATAGG + Intergenic
921015044 1:211181910-211181932 CAGTAAAAGTAGAAGAAAACCGG + Intergenic
921101738 1:211934445-211934467 CAGTGAAAGGAGAAAGGAATGGG - Intergenic
921253943 1:213322723-213322745 AAGAAGAAGGAGAAAGAAAATGG - Intergenic
921396836 1:214677595-214677617 CAGAGAAGGGATATGGAAATAGG - Intergenic
921542555 1:216433971-216433993 CAGATAACAGGGAAGGAAATGGG + Intergenic
922351224 1:224736126-224736148 CAAAAAAAGAAAAAGGAAAAAGG - Intronic
922453085 1:225752282-225752304 CAGAACAGGGGGAAGAAAATGGG - Intergenic
922626728 1:227053736-227053758 AAGAAAAAGTAGAAGAAAATGGG + Intronic
923062147 1:230485554-230485576 ATGAAAAAAGAGAAGGAAAAAGG - Intergenic
923261530 1:232272471-232272493 CAAAAACAAGAAAAGGAAATGGG - Intergenic
923268488 1:232334644-232334666 GAGAAAGAGGAGAAGGGAAGAGG - Intergenic
924227077 1:241930877-241930899 AAGAAAAAAGAAAAGGAAAAAGG + Intergenic
924274725 1:242374270-242374292 CAGAACCAGGAAAAGGAAAACGG + Intronic
924750958 1:246889252-246889274 AAGAGAAAAGAAAAGGAAATAGG - Intronic
924811833 1:247409756-247409778 CAGGAAAAGGAGAAGATAAATGG + Intergenic
924847700 1:247789743-247789765 CAGACAGAGGAGAAGGGACTGGG - Intergenic
1063053252 10:2475987-2476009 CAGAACAATGAGAAGGGCATGGG - Intergenic
1063073842 10:2694902-2694924 CAGAAACAGGACAGGGAAACAGG + Intergenic
1063083793 10:2794367-2794389 CAGAAAAAGAAGAATAAAAGGGG + Intergenic
1063292084 10:4760165-4760187 AGGAAAAAGGAGAAGAAAAGAGG + Intergenic
1063602965 10:7498640-7498662 CAGAAAACGGAGAGGGCAGTTGG + Intergenic
1063693095 10:8305890-8305912 GAGAAAAGGGAGAAAGAAATAGG - Intergenic
1063877020 10:10490664-10490686 CAGAAAAAAGTGAAGAACATAGG + Intergenic
1063901266 10:10734668-10734690 AAGAGAAAAGGGAAGGAAATAGG + Intergenic
1064048181 10:12037937-12037959 AAGAAAAAGGAGAAGGAAAAAGG - Intronic
1064165068 10:12978747-12978769 CAGAATAAGGAAATGGAAAGAGG + Intronic
1064402517 10:15033479-15033501 AAGAAAAAGGAGAAGAAAGAGGG + Intronic
1064697018 10:17976895-17976917 CAGAGAAAGGAGAAAGAGAAAGG - Intronic
1064759214 10:18601553-18601575 CAGAACTAGGAGCAGGAAACAGG + Intronic
1064848880 10:19687544-19687566 GAGAAATAGGACAAGGAAAGTGG - Intronic
1064853276 10:19735054-19735076 CATGAAAAGCAGAAAGAAATGGG - Intronic
1064895787 10:20234682-20234704 CAGAATAAGAAGCAGGAAAAAGG - Intronic
1065414125 10:25466076-25466098 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
1065519603 10:26558858-26558880 CACAAAGAGAAGAAGGAAATGGG - Intronic
1065692298 10:28347052-28347074 CAGGAAAGGGAGAAAGAAAGAGG + Intergenic
1065835369 10:29652986-29653008 AAAAAAAAGGAAAAGGAAAAAGG - Intronic
1066067755 10:31774630-31774652 AAGAAAAAGGAGGAAGAAAGGGG + Intergenic
1067070190 10:43125440-43125462 CAGAAAAAGGAGCCAGGAATGGG + Intronic
1067164845 10:43857089-43857111 AAGAAAAAGAATAAGAAAATAGG + Intergenic
1067355538 10:45521868-45521890 CAGAGAAAGAAAAAGTAAATGGG - Intronic
1067518879 10:46979634-46979656 CACAAAAAAGAGATGGAATTTGG + Intronic
1067545313 10:47188463-47188485 GAGGAGAAGGAGAAGGAAGTGGG + Intergenic
1067643368 10:48072200-48072222 CACAAAAAAGAGATGGAATTTGG - Intergenic
1067893823 10:50158693-50158715 CAAAAAAAGGAGGTGGATATTGG - Intergenic
1067955022 10:50781574-50781596 CAAAAAAAGGAGGTGGATATTGG + Intronic
1068003969 10:51371007-51371029 CGGACAAATGAGAAGGAAACTGG - Intronic
1068026688 10:51654223-51654245 CAGAAGCAGAAGAATGAAATTGG - Intronic
1068278801 10:54839557-54839579 CAGAAAAAGGAGAGAGAGAAGGG + Intronic
1068383806 10:56296576-56296598 CAGTAAAATGTGAAGTAAATAGG + Intergenic
1068716158 10:60191029-60191051 CAGATGAAGGAGAATGAAACTGG + Intronic
1068927872 10:62558794-62558816 CTTAAAGATGAGAAGGAAATAGG + Intronic
1068974231 10:62990957-62990979 AAGAAAAAAAAGAAGAAAATTGG - Intergenic
1069033951 10:63629209-63629231 AAGAAAAAGGAAAACGAAAAGGG + Intergenic
1069055862 10:63844088-63844110 AAGGATAAGGAGAAGGAAATAGG - Intergenic
1069071375 10:63993545-63993567 CACTTAAAGGAGAAGGAAAGAGG - Intergenic
1069077852 10:64056866-64056888 CAGAAAAACCAAAAGGGAATAGG - Intergenic
1069119432 10:64550605-64550627 CAGAAGAAGGAGATAGAAAAGGG - Intergenic
1069171352 10:65233842-65233864 AAAAAAAAAGAGAAGGAAAATGG - Intergenic
1069219081 10:65860709-65860731 CAGAAGAAGAAGAAAGAAACAGG + Intergenic
1069268633 10:66495003-66495025 CAGAAAATGCAGAGGGGAATGGG + Intronic
1069846302 10:71374211-71374233 AAGACAGAGGAGAGGGAAATAGG - Intergenic
1069900274 10:71702846-71702868 CAGGAAAAGGATAGGGAGATGGG + Intronic
1070116514 10:73534196-73534218 AAAAAAAAGGAGAAAGAAACTGG - Intronic
1070298460 10:75185087-75185109 TAGTAAAATGATAAGGAAATTGG + Intergenic
1070342938 10:75514295-75514317 AAGAAGAAGAAGAAGGAAAAAGG - Intronic
1070379553 10:75868350-75868372 CATAAAAAGAAAAAGGAAACAGG - Intronic
1070777409 10:79117934-79117956 TGGGAAAAGGAGAAGGCAATAGG - Intronic
1070963089 10:80512580-80512602 CAGAAAAAGGACAGGGAAGAGGG - Intronic
1071136736 10:82462321-82462343 CAGAGACAGAAGAAGAAAATGGG - Intronic
1071167447 10:82823028-82823050 CAGAAGAAGGAAAAGTAAAAGGG - Intronic
1071326908 10:84527030-84527052 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1071547963 10:86542889-86542911 AAAAAAAAGAAGAAGAAAATGGG + Intergenic
1071710858 10:88047833-88047855 CAGAGAAAGGAAAAGGAAAGGGG - Intergenic
1072101574 10:92234117-92234139 AAAAAAAAGGAGAAGGATAAAGG + Intronic
1072113507 10:92346481-92346503 AAAAAAAAAAAGAAGGAAATAGG - Intronic
1072133727 10:92522872-92522894 AAGAAAAAGGAGGAAGAAAATGG + Intronic
1072214426 10:93276236-93276258 AAGAAAAAGAAAAAGAAAATGGG - Intergenic
1072381233 10:94873073-94873095 CAGTGAAAGGAGAAGCAAACAGG + Intergenic
1072398726 10:95073775-95073797 CATAAACAGAAGAATGAAATTGG - Intergenic
1072412612 10:95217357-95217379 AAGAAAAAGAAAAAGAAAATAGG + Intronic
1072532648 10:96333833-96333855 CAGAAAATGGACAGGGAAAAGGG + Intronic
1072713492 10:97734035-97734057 AAGAAAAAGAAAAAAGAAATGGG + Intergenic
1072866707 10:99069900-99069922 CATAACAAGGAGAGGGAAAGTGG + Intronic
1073155111 10:101340275-101340297 CAGAAAAGGGTGAAAGAAGTGGG + Intergenic
1073644085 10:105281678-105281700 CAGAAAGGTGAGAAGTAAATAGG - Intergenic
1073833554 10:107414934-107414956 AAGAAGAAAGAGAAGGAAGTTGG + Intergenic
1074180917 10:111062078-111062100 CACAAAAAGGAGAAAGAGACAGG + Intergenic
1074503709 10:114047970-114047992 AAAAAAAAGGAAAAGGAAAAAGG + Intergenic
1074543680 10:114386238-114386260 AATAAAAAGGAAAAGGAACTGGG + Intronic
1074792826 10:116908871-116908893 CAGTAAATGGAGAAAGAAGTTGG - Intronic
1074863347 10:117530005-117530027 CTGAAAAAAAAGAAGGAATTAGG - Intergenic
1075451437 10:122554474-122554496 AAGAATGAGGACAAGGAAATTGG - Intergenic
1076705207 10:132297653-132297675 AAGAAAAAGGAAAAAGAATTGGG + Intronic
1076870882 10:133193569-133193591 AAGAACAAGAAGAAGGAAAAAGG + Intronic
1076870885 10:133193582-133193604 AGGAAAAAGGAGAAGGAAGGAGG + Intronic
1077003200 11:335703-335725 GAGAAAATGGGGCAGGAAATAGG - Intergenic
1077519515 11:3023829-3023851 AAGAAGAAGTAGAAAGAAATAGG - Intronic
1077586976 11:3461277-3461299 AAAAAAAAAGAAAAGGAAATAGG - Intergenic
1077715865 11:4579931-4579953 CAGAAAAAGCAGAGAAAAATAGG - Intergenic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1077948196 11:6925904-6925926 GAGAGAAAATAGAAGGAAATGGG - Intergenic
1078106761 11:8362777-8362799 GAAAAAAAGGAGAAGGAAGCTGG - Intergenic
1078317054 11:10303069-10303091 AAGTGAAAGGAAAAGGAAATGGG + Intergenic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078626300 11:12962050-12962072 AAGAAAATGGAAAAGAAAATAGG + Intergenic
1078684397 11:13514649-13514671 AAGAAAAAGAAGAATGAAGTTGG + Intergenic
1078893918 11:15581354-15581376 AAGAAAAAGGAAAAAAAAATAGG - Intergenic
1078930225 11:15906732-15906754 GGGCAAGAGGAGAAGGAAATGGG + Intergenic
1078953191 11:16159009-16159031 CAAAGAAAGGAGATGGAAAATGG - Intronic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1079477863 11:20850012-20850034 TAGAAAGAGGGGAAGGAATTTGG + Intronic
1079497078 11:21057003-21057025 GAGAAAAAGGATAAGAAAAGGGG + Intronic
1079693830 11:23453763-23453785 CAAAATAAGGACTAGGAAATGGG + Intergenic
1079721007 11:23814537-23814559 CAGGAATAGGAGGAGGAAAAAGG - Intergenic
1079780718 11:24599507-24599529 CAGAACAATGACTAGGAAATAGG - Intronic
1079834148 11:25310350-25310372 AAGAAAAAAGAGAAAGAAAGAGG + Intergenic
1079887259 11:26003793-26003815 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1079991480 11:27251006-27251028 AAGAAAAAGGAAAAGAAAAAGGG + Intergenic
1080417564 11:32083158-32083180 CGGCAAAAGGATAAGGAAGTAGG - Intronic
1080496233 11:32823108-32823130 AAGAAAAAGGAAAAGGAAAAAGG + Intergenic
1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG + Intergenic
1080857404 11:36124203-36124225 GACAAAAAGGAGAAGGAATGAGG - Intronic
1080956319 11:37099879-37099901 GAGAAAAAAGGGAAGGAAGTAGG - Intergenic
1081111547 11:39140364-39140386 CAGACAGAAGAGAAAGAAATTGG + Intergenic
1081126319 11:39327569-39327591 CAGAAAAAGGAAAGTGACATAGG - Intergenic
1081207743 11:40294117-40294139 CAGAGAAAGGGAAAGGAAAAGGG - Intronic
1081299927 11:41438493-41438515 CTGAAAGAGTAAAAGGAAATTGG + Intronic
1081314895 11:41620220-41620242 TAGCAAAAGGAAAAGGAACTAGG + Intergenic
1081317072 11:41642966-41642988 CAGAAGCAGAAGAATGAAATTGG - Intergenic
1081335070 11:41855377-41855399 AAGAAAAAGGGACAGGAAATTGG + Intergenic
1081473177 11:43396227-43396249 CAGAAAAAAAAAAAGGAAAAAGG - Intronic
1081594501 11:44449977-44449999 CAGAAGTTGGAGAAGGAAAAAGG + Intergenic
1081651643 11:44827823-44827845 CAGAGAAAGGAGAGGGACATGGG + Intronic
1081842512 11:46213297-46213319 TAAAAAAAGGAGAAGGACAGAGG - Intergenic
1082247769 11:49944387-49944409 CACAAACAGAAGAATGAAATTGG + Intergenic
1082887465 11:58102338-58102360 CAGAAAGAGCAGAAGGAGAAAGG - Intronic
1082983550 11:59145620-59145642 CAAAAAAAGGAAAATAAAATGGG - Exonic
1083344311 11:61978898-61978920 GAGAAAGAGGAGAAGGACAAAGG + Intergenic
1083355709 11:62064536-62064558 GAGAAAAAGGAGCAGGTAAAAGG + Intergenic
1084511955 11:69611614-69611636 CAGAAACAGAAGAAGAAAAAAGG - Intergenic
1084728660 11:71059257-71059279 CTGAAAATCTAGAAGGAAATAGG + Intronic
1085146003 11:74198288-74198310 AAGAAAAAAGAGAAAAAAATGGG - Intronic
1085306464 11:75488724-75488746 CACAAAAAGGAGGAGGCAGTGGG - Intronic
1085601444 11:77859523-77859545 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1085687554 11:78637925-78637947 CAAAAAAAAAAGAATGAAATAGG - Intergenic
1086185733 11:84013264-84013286 GAGAAAAAGTAGAAGAAACTAGG - Intronic
1086441659 11:86834798-86834820 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1086531485 11:87791578-87791600 CATATATAGAAGAAGGAAATTGG + Intergenic
1086775143 11:90821365-90821387 CTGAAAAAGGAGAAAGAGATGGG + Intergenic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1086812740 11:91331191-91331213 TAGAAAAGGGAGAAGAAAATTGG + Intergenic
1087133861 11:94694732-94694754 CAGAAACAGGTGATGGAAACTGG + Intergenic
1087159745 11:94937024-94937046 CAGTAGAATGAGAAGGAAAGAGG - Intergenic
1087846228 11:102976611-102976633 GAGAAAAAGGGAAAGGAAAAAGG - Intergenic
1087911078 11:103754007-103754029 CAAAACAATGAGAAGGAAAATGG + Intergenic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088042405 11:105403214-105403236 CAGAAAAAGGAAAAAGAAAAAGG + Intergenic
1088070178 11:105773627-105773649 CAGACAAAGCAAAAGGAAAAGGG + Intronic
1088141084 11:106617133-106617155 GAGAAAAAGAAGAAAGAAAAAGG - Intergenic
1088541816 11:110920978-110921000 GAGAAAAAGCAGTAAGAAATGGG - Intergenic
1088622250 11:111697829-111697851 CAAAAAAAGGAAAAGAAAAAAGG + Intronic
1088750471 11:112838315-112838337 CAGAAATATGAGCAGTAAATTGG - Intergenic
1089019394 11:115197060-115197082 CAGAAAGGGCAGAAAGAAATAGG + Intronic
1089364541 11:117913322-117913344 CATCAAATGGAGAATGAAATGGG - Intronic
1089560581 11:119341257-119341279 CTGAAAAAGCAGATGGAAAGGGG + Exonic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089772660 11:120814839-120814861 AAGAAAAAGGGAAAGAAAATGGG - Intronic
1089922872 11:122227586-122227608 CAGAAAAAAAAAAAGAAAATAGG - Intergenic
1090013155 11:123062515-123062537 CGGAAAAAGGAGGAGGAAGAGGG + Intronic
1090474238 11:127004975-127004997 CAGATAAATGAAAAAGAAATAGG - Intergenic
1091066011 11:132513659-132513681 CAAAAGAAGGAAAATGAAATGGG - Intronic
1091112411 11:132982157-132982179 CAGCAAAGGCAGAAGAAAATGGG - Intronic
1091166459 11:133480396-133480418 CAGAAAAAGCAGAAGGCAGTGGG - Intronic
1091383241 12:76535-76557 CAGAGAAAGGAAAAGGAACTGGG - Intronic
1091439490 12:501586-501608 AAGAAAAAGGAAAAAGAAATAGG + Intronic
1091459948 12:636552-636574 TCAAAAAAGGAGAAGGAACTAGG + Intronic
1091512560 12:1144060-1144082 AAGTAGAAGGAGAAGGAAATGGG - Intronic
1091536194 12:1412196-1412218 AGGAAACAGGAGAAGGAAAGTGG - Intronic
1091694920 12:2622042-2622064 GAGAGGAAGGAGAAGGAAAGGGG + Intronic
1092288187 12:7142091-7142113 AAGAACAAAGAGAAGGAAAAGGG + Exonic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092413213 12:8270026-8270048 CAAAAAAAAGAAAAGAAAATAGG - Intergenic
1092470952 12:8780341-8780363 CAAAAAAAGTAGAAAGAAAGTGG - Intronic
1092586490 12:9906211-9906233 CAGAAAACCAAGAAGGAAAATGG - Intronic
1092724146 12:11468541-11468563 AAGAAAAAAGAGAATGAAAGGGG - Intronic
1093348671 12:18070447-18070469 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1093377374 12:18446858-18446880 AAGAAAAAAGTGAAGGAAAAAGG - Intronic
1093612031 12:21172625-21172647 AAGAAAAATCAGAAGGAAAGGGG - Intronic
1093622971 12:21313995-21314017 CAGAAAAAAAAGAAAGAAATTGG + Intronic
1093662901 12:21777068-21777090 CAGAAAAATAATAAGAAAATTGG + Intergenic
1093741085 12:22690045-22690067 CAGAAGAAAAAGAATGAAATTGG + Exonic
1093969358 12:25360840-25360862 CAGAAAAGGGAGCAAGAAACTGG - Intergenic
1094083775 12:26566220-26566242 GAGAAGAAGGAGGAGGAAAGAGG + Intronic
1094229096 12:28082438-28082460 CAGGAAAAAGAAAAGGAAGTAGG + Intergenic
1094269316 12:28594243-28594265 CAAAAAAAGATGAAAGAAATAGG + Intergenic
1094283644 12:28768255-28768277 GAGAAAAAGGAGAAAGACACTGG + Intergenic
1094397066 12:30019052-30019074 CAGAAAAAGGAGATGAAAGGAGG + Intergenic
1094546303 12:31407531-31407553 AAGACAAAGGAAAAGGGAATTGG - Intronic
1094566911 12:31607126-31607148 CAGCAAAGGCAGAAGAAAATTGG - Intergenic
1094624223 12:32107248-32107270 GGGGAAAGGGAGAAGGAAATGGG - Exonic
1094806779 12:34101709-34101731 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1095044283 12:37483105-37483127 CAGAGGAAGCAGAAGGCAATGGG + Intergenic
1095215590 12:39543743-39543765 GAAAAAAGGGAAAAGGAAATAGG - Intergenic
1095295486 12:40522613-40522635 AAGAAAGAGGAGAATGAAAAAGG - Intronic
1095295911 12:40527261-40527283 AAGAAAGAGGAGAATGAAAAAGG - Intronic
1095739307 12:45589802-45589824 CAGAAAGAGGAGTAGGATAGAGG + Intergenic
1095882566 12:47153811-47153833 CAGTTCATGGAGAAGGAAATAGG - Intronic
1096101580 12:48973242-48973264 AAGAAAAAGGATAAGGACACTGG - Intergenic
1096249367 12:50018532-50018554 CAGAAACAGGGGCAGGACATTGG + Intronic
1096351752 12:50906452-50906474 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1096378168 12:51131825-51131847 CAGAAAAAGGAGAGGAAAGAAGG - Intronic
1096396299 12:51269412-51269434 GAGAAAAAGGGGAAGGGACTTGG - Intronic
1096586148 12:52621272-52621294 CAGAAAAGAGAGAAAGAAAGGGG + Intergenic
1096729697 12:53598509-53598531 CAGAAACAGGAGACAGAAGTAGG + Intronic
1096733058 12:53630042-53630064 TCGAAAAAAGAGAACGAAATTGG - Intergenic
1096749141 12:53747784-53747806 CAGGAAGGGGAGCAGGAAATAGG - Intergenic
1097323249 12:58248121-58248143 CAAAAAAAAAAAAAGGAAATAGG - Intergenic
1097493337 12:60297124-60297146 CAGGAAAGGGAGAAGTAAAATGG + Intergenic
1097594866 12:61616658-61616680 CAGGCAAAGGAGAAGGAGATTGG - Intergenic
1097611650 12:61830589-61830611 CAGAAAAATGGGAATGAGATGGG + Intronic
1097704754 12:62856373-62856395 CTGAAAGATGGGAAGGAAATGGG - Intronic
1097742054 12:63254675-63254697 AAAAAAAAGAGGAAGGAAATTGG - Intergenic
1097880374 12:64681149-64681171 AAGAATGAGGAGAAGGAAAAGGG - Intronic
1097934009 12:65224832-65224854 CAGAAAGAGAAGAAAGAAACAGG - Intronic
1098150484 12:67541385-67541407 CAGAATAAGCAGAAGGGTATTGG + Intergenic
1098472618 12:70862973-70862995 CATAAAAGGAAGAAGGAAACTGG + Intronic
1099048464 12:77753650-77753672 TAGAAAAAGGAGGGGGAAGTAGG + Intergenic
1099230605 12:80019608-80019630 CGAAAAAAGTAGGAGGAAATTGG + Intergenic
1099539433 12:83887899-83887921 CAAAGAGAGGGGAAGGAAATGGG - Intergenic
1099565587 12:84241661-84241683 CAGGCAAAGTAGAATGAAATTGG - Intergenic
1099616430 12:84941516-84941538 AAGGAAAAGGAGAAGGAGAAGGG + Intergenic
1099802760 12:87477555-87477577 CAGATGAAGGAGAAGGTTATAGG - Intergenic
1099851478 12:88102506-88102528 GAGAAAAAGGAGCATGAAACAGG - Intronic
1100416631 12:94384732-94384754 GAGAATAAAGAGAAGAAAATTGG - Intronic
1100445791 12:94658241-94658263 CAGAAAGAAGACAAGGAAAAGGG + Intergenic
1100491078 12:95078644-95078666 CAGAAAAAGGGAAAAGAGATTGG + Exonic
1100608617 12:96171940-96171962 CAAAAAAAAAAGAAGGAACTGGG - Intergenic
1100647229 12:96544460-96544482 GAGAAAAAGGAGCAGGAGAAAGG - Intronic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1101008889 12:100429936-100429958 CAGAAGAAAGAGAAGGGAAGAGG - Intergenic
1101011144 12:100450850-100450872 AAGACAAAGGAGAGGGAAAACGG + Intergenic
1101127795 12:101655795-101655817 CAGAAAAAGGAAAATAATATAGG + Intronic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102408767 12:112698837-112698859 AAGGAGAAGGAGAAGGAAAAGGG - Intronic
1102731262 12:115112724-115112746 AAGAAAAGGCAGAAGGAGATTGG - Intergenic
1102766369 12:115437003-115437025 CAAAGCAAGGGGAAGGAAATAGG + Intergenic
1102925207 12:116821199-116821221 TAGAAACAGGAGGGGGAAATGGG - Intronic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1103049784 12:117769004-117769026 TAGGAAATGCAGAAGGAAATTGG + Intronic
1103129746 12:118457730-118457752 AAGAAAAAGGAGAAAGAATTTGG + Intergenic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103436564 12:120931426-120931448 GAGAAATAGGATCAGGAAATTGG + Intergenic
1103546532 12:121705637-121705659 TAGAAAGAGGAGGAGGAAAGAGG + Intergenic
1103592591 12:122002869-122002891 CAATAAAAGGAGAGGGAAAAGGG - Intronic
1103710939 12:122912192-122912214 CAGAAAAAGGAAAAGCAAGAGGG - Intergenic
1103795207 12:123498623-123498645 CAGACCAAGGAGCAGGAGATGGG - Exonic
1104248199 12:127062954-127062976 TATAAAAAGGAAAGGGAAATGGG - Intergenic
1104316236 12:127704425-127704447 GAGGAAGAGGAGAAGGAGATTGG + Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104448087 12:128848905-128848927 GAAAAAAAGGAGGAGGAAAGAGG + Intergenic
1104657716 12:130585925-130585947 GAGAAAAGAGAGGAGGAAATGGG + Intronic
1104674347 12:130702622-130702644 AAGATGAAGGAGAAGAAAATAGG + Intronic
1104851169 12:131874865-131874887 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1105237500 13:18572047-18572069 AAGAAAGAGAAGAAGGAAACAGG - Intergenic
1105272552 13:18891941-18891963 CAGCAAAAGGAGAAGCAAAGGGG + Intergenic
1105572846 13:21620348-21620370 AAGAGAAAGGAGAAGGAGATTGG - Intergenic
1105963518 13:25364595-25364617 CAGGAAAATGACAAGGACATGGG - Intergenic
1106030577 13:25998510-25998532 CAGACAAAGGAACAGGAAAGGGG - Intronic
1106652882 13:31710813-31710835 AAAGTAAAGGAGAAGGAAATTGG - Intergenic
1106697069 13:32186595-32186617 GAGAAATATGAGAAGAAAATGGG - Intronic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1106827105 13:33535223-33535245 AAAAAAAAGGAGAACCAAATGGG + Intergenic
1106915283 13:34507208-34507230 CAGAGAAAGAAGAAGAAAAATGG - Intergenic
1106969637 13:35122942-35122964 CTCAAAAAGGAGAAAGAACTAGG + Intronic
1107036725 13:35910007-35910029 AAGACAAAGGAGAAGCAAAGCGG - Intronic
1107182775 13:37481194-37481216 AAGAAAAAGGAGATGTAAATGGG - Intergenic
1107229413 13:38089957-38089979 CATCCAAAGGAGAAGTAAATGGG - Intergenic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107263238 13:38520076-38520098 AAGAAAAGGGAAAAGTAAATGGG - Intergenic
1107312043 13:39089761-39089783 CATCAAAAGGAGATGGAAAAGGG + Intergenic
1107335756 13:39353372-39353394 CAGAAAATGTAGAAGTAAAACGG + Intronic
1107397251 13:40030613-40030635 CAGAAGGAAGAGAAAGAAATGGG - Intergenic
1107407749 13:40130373-40130395 GAGAAGTAGGAGAAAGAAATGGG + Intergenic
1107442255 13:40438543-40438565 CAGCAAAAAGAAAAGGAAACTGG - Intergenic
1107996052 13:45862184-45862206 GAGAGAAAGGGGAAGGAAAAGGG + Intergenic
1108274904 13:48797783-48797805 CATGAAAAGGAACAGGAAATTGG + Intergenic
1108726720 13:53191236-53191258 GATTAAAAGGAGAAGGAAAGAGG + Intergenic
1108770067 13:53688832-53688854 GGGAAAAAGGAGAAGGAGACAGG + Intergenic
1109039132 13:57309079-57309101 AAGAAAAAGGAGAAAGAAGTGGG - Intergenic
1109040780 13:57333589-57333611 CTGAAACAGGAGAAGGGGATAGG + Intergenic
1109106473 13:58258161-58258183 CACAAAAAGAAGAATGAAAATGG - Intergenic
1109373688 13:61459626-61459648 CAGAAAATGAAGAAGGAAAGAGG - Intergenic
1109421923 13:62124435-62124457 CTAAAAAAAAAGAAGGAAATAGG - Intergenic
1109556870 13:63987536-63987558 AAGAGAAAGGAGAAGAAAAGTGG - Intergenic
1109580409 13:64324184-64324206 CTGAAATAGGAAAAGGGAATGGG + Intergenic
1109606631 13:64705813-64705835 CAGAATTAAGAGAAGGAAAAGGG - Intergenic
1109658392 13:65425985-65426007 AAGAAAAAGGAGTGGGGAATAGG + Intergenic
1109807247 13:67459652-67459674 CAGAAGATGAAGAAGGAAATAGG + Intergenic
1109842645 13:67940101-67940123 CAGAAAAAGGAGAAAGACCATGG + Intergenic
1109847613 13:68016380-68016402 CATAAAGAGAAGAAGGAAAAAGG - Intergenic
1109898641 13:68731328-68731350 AAGAAGCAGGAGATGGAAATTGG - Intergenic
1110063312 13:71068529-71068551 CAAAAAAAGAAAAAGAAAATAGG - Intergenic
1110502649 13:76246775-76246797 AAAAAAGAGGAGAAGGAAAGAGG - Intergenic
1110541954 13:76716236-76716258 AAGAAAAAGGATAAGGAACAGGG + Intergenic
1110757590 13:79194128-79194150 CAGCAAAGGTATAAGGAAATAGG - Intergenic
1110811437 13:79815227-79815249 AAGGAAAAGGAAAAGGAAAAGGG - Intergenic
1111112209 13:83728170-83728192 CAGAAAATGCAAAATGAAATAGG - Intergenic
1111209257 13:85055324-85055346 GAGTAAAGGGAGAAGGACATAGG - Intergenic
1111512115 13:89279722-89279744 CAGAAATACAAGAAGGAGATTGG + Intergenic
1111633249 13:90870481-90870503 CAGAAGAAGGGGAAGGACAAGGG - Intergenic
1112100258 13:96180873-96180895 GAAAAAAAGGAGAAGGAAAGAGG - Intronic
1112105318 13:96233608-96233630 CCGAAAACACAGAAGGAAATTGG + Intronic
1112206584 13:97329872-97329894 CTGAAAAATGAGTAGGAACTTGG - Intronic
1112234894 13:97626424-97626446 AAGAAAAATCACAAGGAAATTGG - Intergenic
1112284740 13:98094304-98094326 AAGAAAAAGAAAAAAGAAATAGG - Intergenic
1112358365 13:98693727-98693749 CAAAAAAAGGAAAAAGAATTTGG - Intronic
1112554248 13:100452154-100452176 AAGAAAAAAGAGAAGGAGAGAGG - Intronic
1112755138 13:102624286-102624308 GGGAAAAAGGAGAATGAAGTGGG + Intronic
1112794133 13:103036297-103036319 CAGAAAAATGGGAGGAAAATGGG + Intergenic
1112798978 13:103089476-103089498 AAAAAAAAAGAGAAGGAAATAGG + Intergenic
1112844680 13:103625549-103625571 CAGAGAAAGGAGAATGACTTTGG - Intergenic
1112930679 13:104732520-104732542 CAGAAGGAGGAGAAGAAAAGGGG - Intergenic
1112960654 13:105121219-105121241 AAAAAAAAGGAAAAGGAAAAAGG + Intergenic
1113012250 13:105782229-105782251 CAAAAAAAAAAGAAAGAAATTGG + Intergenic
1113032307 13:106007750-106007772 CAAAAAAAGAAAAAGGAAACAGG - Intergenic
1113063621 13:106352122-106352144 TAGAAAAAAGAGAGAGAAATAGG - Intergenic
1113140949 13:107148503-107148525 GAGAAAAAGGAGGAGAAAAGAGG + Intergenic
1113238235 13:108306022-108306044 AAGAAGAAAGAGGAGGAAATGGG - Intronic
1113455946 13:110449145-110449167 GAGAAGAATGAGAAGAAAATAGG - Intronic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1114384636 14:22242470-22242492 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1114411483 14:22504684-22504706 CAAAAAAAGAAGAAGGAAGCTGG + Intergenic
1114450100 14:22819765-22819787 CAGAAAAAGCAGAGGGTAACGGG + Intronic
1114540637 14:23455207-23455229 TACCAGAAGGAGAAGGAAATGGG + Intergenic
1115108051 14:29784999-29785021 CAGTAAAAGGAGATGGAATTTGG - Intronic
1115365132 14:32549378-32549400 CAGATAAAGGAAAAGGAAGGTGG + Intronic
1115395014 14:32898738-32898760 AAGAAAAAGGAAATGGAAAAGGG - Intergenic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115726535 14:36223303-36223325 CAGAGGAAGGATAAGGAAAGAGG + Intergenic
1116122795 14:40742200-40742222 CAAAAGAAGGCGGAGGAAATAGG - Intergenic
1116224623 14:42133680-42133702 GAGAAAAATGAGAAAGATATTGG - Intergenic
1116251167 14:42484089-42484111 CAAAAACAGGAAAAGGATATTGG - Intergenic
1116377437 14:44221332-44221354 AAGAAAAAGAAGAAAGAAAGAGG + Intergenic
1116447128 14:45023008-45023030 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1116797575 14:49408261-49408283 AAGAAAAAGGAGGAGGAAAGAGG + Intergenic
1117053982 14:51891551-51891573 AAGAAAAAGGAGGATGGAATTGG - Intronic
1117275019 14:54184694-54184716 CAGCAAAAGGAAAAGGAGAAAGG + Intergenic
1117435689 14:55713304-55713326 CAGAAAAATGGGAATGACATGGG + Intergenic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1117963639 14:61186158-61186180 GACAAAGAGGAGAAGGAAGTGGG - Intergenic
1118072565 14:62261934-62261956 GAGAAAAAGGAGGAGGAAAGTGG - Intergenic
1118313938 14:64713757-64713779 CAGAGAAAAAAAAAGGAAATGGG - Intronic
1118626080 14:67660578-67660600 CAGAAAGAGGAGCAGGAGAAGGG - Intronic
1118637694 14:67762890-67762912 CAGAAAAAAGAAAATGGAATAGG - Intronic
1118656244 14:67952706-67952728 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1118704934 14:68471794-68471816 CAGACAAAGGAGATGCAAACAGG - Intronic
1119100115 14:71871721-71871743 CAAAAAAAGGGAAAGGAAAGAGG - Intergenic
1119101706 14:71885931-71885953 GAGAAAAAAGAGAAGGAGAGTGG - Intergenic
1119346715 14:73931112-73931134 CTCAAGTAGGAGAAGGAAATAGG - Intronic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119587010 14:75845556-75845578 GAGGAACAGGAGAAGGAAAAGGG + Intronic
1119856660 14:77906165-77906187 CAGAATTAGGAACAGGAAATAGG + Intronic
1119873872 14:78040088-78040110 TTGAAAAAGGAGAACGAAGTTGG - Intergenic
1119936510 14:78597052-78597074 CAGAAAAAGAAAAAGTAAAGAGG - Intronic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120332971 14:83117092-83117114 CAGATAAAGGAGGAGAAAAATGG - Intergenic
1120520834 14:85526589-85526611 AAGAAAAAGAAAAAGGAAAAAGG - Intergenic
1120556526 14:85934546-85934568 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
1120625356 14:86818962-86818984 CAGAAAAATGAGAATAATATAGG + Intergenic
1120731881 14:88012881-88012903 TATATAAAGGAAAAGGAAATAGG + Exonic
1120765878 14:88326134-88326156 CTGAGAAAGGAGAATGAAAGTGG - Intronic
1120873773 14:89360471-89360493 GAGAAAGAGGGGAAGGAAAGAGG + Intronic
1120941447 14:89954372-89954394 GAGAGAAAGGAGATGGAACTTGG + Intronic
1120955688 14:90079930-90079952 CTGAAAGTGGAGAAGGAAACAGG + Intronic
1120999285 14:90439950-90439972 AAGACAAGTGAGAAGGAAATGGG + Intergenic
1121593301 14:95137297-95137319 AAGAAAAAGGAAAAGGGAAAGGG + Intronic
1121704719 14:95982917-95982939 CCGAAGAAGGAGAAGGAGCTAGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1121778028 14:96603540-96603562 CAGAAAGAGGAGTAGCAAAAAGG + Intergenic
1121830170 14:97044570-97044592 AGGAAAAAGGAGCAGGAAAAGGG + Intergenic
1122167139 14:99835562-99835584 CGAAGAAAGGAGAAGGAAGTAGG - Intronic
1122477549 14:102021636-102021658 AAGAAAAAGAAAAAAGAAATGGG - Intronic
1123552633 15:21397851-21397873 CAGAAAAAGCAGATGGCACTGGG - Intergenic
1123588879 15:21835239-21835261 CAGAAAAAGCAGATGGCACTGGG - Intergenic
1123681814 15:22769159-22769181 CAGAAGCAGGAGGAGCAAATGGG - Intergenic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1124035889 15:26053353-26053375 GAGAAAAAGGAAAAAGAAAGAGG + Intergenic
1124124983 15:26930837-26930859 AAGAAAAAAAAGAAAGAAATTGG - Intronic
1124143746 15:27101488-27101510 TTGAAAAAGAAGAATGAAATTGG + Intronic
1124352293 15:28965416-28965438 TTGAAAAAGGAGAATAAAATTGG - Intronic
1124382781 15:29180915-29180937 GAGAAAAAGAAAAAGGAATTTGG + Intronic
1125168719 15:36741251-36741273 CATAAAAAGGAGAGGCATATGGG + Intronic
1125283256 15:38066092-38066114 GAGAAAAAGGGGAAGGAGAGAGG + Intergenic
1125670054 15:41465088-41465110 AAGAAAAAAGAAAAGGAAAAAGG - Intronic
1125784847 15:42307157-42307179 CAGAATAGGGAGGAGGAAAGAGG - Intronic
1126450783 15:48806340-48806362 CAGAAGCAGCAGCAGGAAATGGG + Intronic
1126558271 15:50015244-50015266 AAGAAAATGAAGAGGGAAATTGG + Intronic
1126752165 15:51887220-51887242 CAAAAAAAAAAAAAGGAAATTGG + Intronic
1126887127 15:53163146-53163168 CAGAAGAAGGGGAAGAAATTGGG + Intergenic
1126931815 15:53661685-53661707 TAAAAAAAGGAGAAAGAAATGGG + Intronic
1127073963 15:55308388-55308410 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1127242657 15:57134917-57134939 CAGGAAAAGGAGGAGGAATGTGG - Intronic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127298390 15:57629897-57629919 GAGAAAAGGGAGAAGTAAAGAGG - Intronic
1127576649 15:60298360-60298382 GAAGGAAAGGAGAAGGAAATAGG + Intergenic
1127691055 15:61398366-61398388 AAAAACAAGGAGAAGGAAAGTGG + Intergenic
1127725846 15:61749125-61749147 CAGAAAAAGGAGATTCAAAGTGG - Intergenic
1127733578 15:61821350-61821372 CAGAAATAGGAGAAGGCATCAGG - Intergenic
1127847900 15:62887461-62887483 TAGAAAAATGAGAGTGAAATGGG - Intergenic
1127860409 15:62989252-62989274 GAGAAAAAGGAGGAAGAAAAAGG - Intergenic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128110368 15:65072214-65072236 CAGGAAGAGGAGGAGGAGATGGG - Intronic
1128206062 15:65852960-65852982 AAAAAAAAGAAGAAGGAAACAGG + Intronic
1128676110 15:69609827-69609849 AAAAAAGAGTAGAAGGAAATCGG - Intergenic
1128755249 15:70179310-70179332 GAAAAAAAGGAAAAGGAAAAAGG - Intergenic
1128756947 15:70189646-70189668 CACACAAAGGCCAAGGAAATGGG + Intergenic
1128847289 15:70910928-70910950 CAGAAAAAGGAAAGAGTAATGGG + Intronic
1129013563 15:72445225-72445247 TAAAAAAAATAGAAGGAAATAGG - Intergenic
1129504400 15:76069309-76069331 CAGAAAAAGCAGGAGGAGATAGG + Intronic
1129771741 15:78207210-78207232 GAGATAAAGGAGAAGGGACTGGG - Intronic
1130009499 15:80139241-80139263 CAGAAAAATGATAAGAAAAGAGG + Intergenic
1130425011 15:83788389-83788411 CATAAAAATGAGGAGGAAAAAGG - Intronic
1130608670 15:85340447-85340469 CAGAAACAGGAGAAGAAAACAGG + Intergenic
1130611449 15:85364884-85364906 CACAACCAGGAGAAGGCAATGGG + Intergenic
1130750044 15:86701862-86701884 AAGAAAAAAGAGAAGGGAAGGGG - Intronic
1131081397 15:89539248-89539270 AAGGAAAAGGAAAAGGAAAAGGG + Intergenic
1131192682 15:90329722-90329744 TAGAAAAAGGAAGAGGACATTGG - Intergenic
1131334459 15:91534407-91534429 CATAAAAAGGAGAGGGAGAATGG + Intergenic
1131559810 15:93429964-93429986 AAGAAAAAAGAAAAAGAAATTGG - Intergenic
1132000986 15:98179897-98179919 AGGAAGAAGGAGATGGAAATGGG + Intergenic
1132034019 15:98465086-98465108 CAGGAAGAGGAAAAGGACATTGG + Intronic
1132425294 15:101710805-101710827 CAGAAACAAGAGAAGGAGAGGGG + Intronic
1202960982 15_KI270727v1_random:125071-125093 CAGAAAAAGCAGATGGCACTGGG - Intergenic
1132913400 16:2327707-2327729 CAGAAAAAAGAAAAAGAAAATGG - Intronic
1133062571 16:3184111-3184133 GGGAAAAAAGAGAAGGAAAAGGG + Intergenic
1133063088 16:3188165-3188187 GGGAAAAAAGAGAAGGAAAAGGG - Intergenic
1133354419 16:5125523-5125545 CAAAAAAAAGAAAAGAAAATAGG - Intergenic
1133368863 16:5232908-5232930 AAGAAGAAGAAGAAGGAAATGGG - Intergenic
1133562782 16:6965295-6965317 CAACAAAAGAAAAAGGAAATTGG - Intronic
1133954831 16:10433170-10433192 AGGAAAAAAGAGAAGGAAATAGG - Intronic
1133982022 16:10640060-10640082 GAGAAGAAGGAGAAAGAAAAAGG - Intronic
1134068687 16:11247068-11247090 AAAAAAAAGGAGAAGGAGAAGGG - Intergenic
1134178368 16:12027265-12027287 CAGAAAAGGGAGTAGCAACTAGG - Intronic
1134237924 16:12482282-12482304 AAGGAAAAGGAAAAGGAAAAAGG - Intronic
1134425037 16:14133610-14133632 GAGAAAAAGCAGAAGGGAAGAGG - Intronic
1135157900 16:20069947-20069969 CTTAAAAAGGAGGAGGAAAGGGG + Intronic
1135166792 16:20146271-20146293 CAGAGACAAGAGCAGGAAATGGG - Intergenic
1135224833 16:20646711-20646733 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135282975 16:21169303-21169325 CAGAAAAAGGGGAAAAAAAAAGG - Intronic
1135344634 16:21678540-21678562 CAGAAAAAGGAATAGGAAAAGGG - Exonic
1135480710 16:22818640-22818662 AAGGAAAAGGAGAAGGGAAAGGG - Intronic
1135682654 16:24471641-24471663 CAGAAGAAGGAGTGGGAAGTAGG - Intergenic
1135718745 16:24795918-24795940 CAAAAAAAGGAGAAGGGAAAGGG + Exonic
1135746247 16:25019039-25019061 CAGTAAAAGGTGAAGAAATTAGG + Intergenic
1135898637 16:26434171-26434193 AAGAAAAAGGAAAAGAAAAAGGG - Intergenic
1136042105 16:27587886-27587908 AAGAAAAAGGAAAGGGAAAAGGG - Intronic
1136081336 16:27854307-27854329 GAGGAAAAGGAGAAGGAAAAGGG + Intronic
1136141421 16:28291564-28291586 CAAAAAAAAAAGAAAGAAATAGG + Intergenic
1137376367 16:47955461-47955483 TAAAACAAGGAGAAGGAAATTGG - Intergenic
1137379321 16:47982833-47982855 CATCAAAAGGAGATGGAATTTGG - Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137704874 16:50528016-50528038 AAAAAAAAAGAGGAGGAAATAGG - Intergenic
1137735548 16:50720445-50720467 CCTAAGAAAGAGAAGGAAATGGG + Intronic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1138044282 16:53704456-53704478 CAGAAGAAGGACAAGGAAATGGG - Intronic
1138133960 16:54505302-54505324 AATAAAAAGGAGAAGGGAGTGGG + Intergenic
1138276608 16:55739612-55739634 CAGGAAAAGGAGGAGGAAATTGG + Intergenic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1138403846 16:56772190-56772212 CAGAAAAAGGATAAAGAACATGG + Intronic
1138618621 16:58193795-58193817 GAGAAAAAGGAGGAGGAAAATGG - Intronic
1138684157 16:58710196-58710218 AAGAAAAAGAAAAAGAAAATGGG - Intronic
1138690395 16:58762430-58762452 CAGAAAAAGAAGAATGAAGTTGG - Intergenic
1138945868 16:61849319-61849341 AAGAAAAAAAAAAAGGAAATTGG + Intronic
1139057900 16:63208503-63208525 CAGAAAAAGAAGAAAGAAAAAGG + Intergenic
1139122130 16:64033299-64033321 AATAAAAAGGAGATGGACATGGG + Intergenic
1139191393 16:64867406-64867428 AAGAAAAAGAAAAAGAAAATTGG + Intergenic
1139232192 16:65294432-65294454 CAGAAAACGGAAAAGGAGAGTGG + Intergenic
1139263902 16:65622115-65622137 CTGAAAAATGAGCAGGAATTAGG + Intergenic
1139390199 16:66602517-66602539 AAGAAGAAGAAGAAGCAAATTGG - Intergenic
1139800087 16:69515452-69515474 GAGAAAAAGGGGCAGGAGATAGG - Intergenic
1140345517 16:74209315-74209337 CAGACAAAGGAGAAAGAAAATGG + Intergenic
1140555689 16:75918530-75918552 CAGAAAGAGCATAAGGAAACGGG + Intergenic
1140989392 16:80193877-80193899 AAAAAAAAGAAGAAAGAAATTGG - Intergenic
1141019305 16:80479975-80479997 AAGAAAAAGAAGAGGGAGATTGG + Intergenic
1141185252 16:81782410-81782432 CAAAAAAAGCAGAAGCAAAATGG + Intronic
1141193759 16:81843939-81843961 AAGAAAAACGAAAAGGAAAAAGG - Intronic
1141921115 16:87136073-87136095 CTGAAATTGGTGAAGGAAATGGG + Intronic
1141931631 16:87208500-87208522 CAGCAAAAAGAGAAGGAGAAAGG + Intronic
1142333610 16:89472222-89472244 CAGAAAAGTGAGAGGCAAATGGG + Intronic
1143228913 17:5334228-5334250 CAAAAAAAAGAGAAGGAAAGGGG - Intronic
1143231994 17:5364231-5364253 CAGAAAAAGAAGTGGGAAAAGGG + Intronic
1143843795 17:9756514-9756536 CATAAAAGGGACTAGGAAATAGG + Intergenic
1143876923 17:9998682-9998704 AAGGAAAAGGAAAAGGAAAAGGG + Intronic
1145029244 17:19492060-19492082 CAGAAATAGTGGCAGGAAATAGG + Intergenic
1145900698 17:28488860-28488882 CAGAAGAAGGAGCAGGACCTGGG - Intronic
1145922399 17:28620080-28620102 TAGAGAAAGGAGAAAGAAATGGG + Intronic
1145956337 17:28857405-28857427 CAGTAAACAGAGAATGAAATCGG - Intronic
1146784699 17:35709113-35709135 GAGAGAAAGAGGAAGGAAATAGG + Intronic
1147022334 17:37546267-37546289 GAGAAAAAGGAAAAAGAAAATGG + Intronic
1147113111 17:38278470-38278492 CAAAAAAAAGAAAAAGAAATAGG + Intergenic
1147416865 17:40298245-40298267 GGGAAAAAGGAGGAGGAAAAGGG - Intronic
1147604442 17:41766315-41766337 AAGGAAAAGGAAAAGGAAAAAGG + Intronic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148006399 17:44434298-44434320 AAGAAAAAGGGGAAAGAAAAAGG + Intronic
1148099746 17:45081693-45081715 CAAAAAAAGAAGAAAGAAAAAGG + Exonic
1148323092 17:46769336-46769358 AAGAAAAAGAAAAAAGAAATAGG + Intronic
1148416510 17:47510764-47510786 CAAAAAAAAGAAAAAGAAATAGG - Intergenic
1148462353 17:47846022-47846044 CATCTAAAGGAGAAGGGAATGGG + Exonic
1148492672 17:48033388-48033410 CAGAAAGGGGAGAAGGAAATAGG - Intronic
1148503026 17:48106451-48106473 CAGAGAAAGGGGAAGCACATAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148717336 17:49725104-49725126 AAGAAAAAGGAGAGGGAGATGGG - Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1149019684 17:51948599-51948621 CAGAATAAGGAGAAGGGACTGGG - Intronic
1149273760 17:55012643-55012665 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1149414321 17:56443118-56443140 GAGTAAAAGGAGAGGGAATTTGG + Intronic
1149478905 17:56985948-56985970 CTGTAAAGGGAGAAGGATATGGG - Intronic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150657197 17:67046993-67047015 CAGAGAAAAGAGAGGGAAAAAGG - Intronic
1150772027 17:68050365-68050387 CAGAAAGAGAAGAAGGAAGGAGG - Intergenic
1150867570 17:68869968-68869990 CAGAAAAATGTGAAGGAAACTGG - Intronic
1150924145 17:69514988-69515010 CAGAAAAAGGCAAAGGAAAATGG - Intronic
1150950294 17:69796059-69796081 AAAAAAAAAAAGAAGGAAATGGG + Intergenic
1151074282 17:71253459-71253481 AAGACAAAGAAGAAGAAAATAGG - Intergenic
1151107083 17:71627813-71627835 GAGAAAGAGGAGAAGGGAAAAGG + Intergenic
1151154219 17:72113547-72113569 CAGAGACAGGAGAAGGGAATAGG + Intergenic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151409877 17:73915546-73915568 CTGAAAAAGAAAAAGGAAAGGGG + Intergenic
1151791083 17:76306432-76306454 AAGAAAAAGCAGAAGCAACTAGG - Intronic
1151825930 17:76524227-76524249 AAGAAAAAGGAAAAGAAAAGAGG - Intergenic
1153022220 18:639792-639814 AAGAAAAAGAAAAAAGAAATGGG + Intronic
1153148677 18:2063845-2063867 TTGAAAAAGGAGAAGGAAAAAGG + Intergenic
1153219973 18:2853021-2853043 GAGGAAGAGGAGAAGGAAAGGGG + Intronic
1153320418 18:3768500-3768522 TTGAAAAAGGAGAAGGAAGGGGG + Intronic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1153589990 18:6663697-6663719 CAGAAACAGAAGAAGAAAAAAGG - Intergenic
1153740548 18:8122349-8122371 GAGAAAAATGAGTGGGAAATGGG - Intronic
1153759097 18:8312940-8312962 CAGCACAGGCAGAAGGAAATCGG - Intronic
1153884654 18:9453355-9453377 CAGAAAAAAGAATAGGATATTGG - Intergenic
1154088647 18:11334981-11335003 CAGAAAAAGGAAAATGATATAGG - Intergenic
1154263008 18:12854374-12854396 AAGAAAAAAGAAAAAGAAATAGG + Intronic
1154464335 18:14629524-14629546 CGGCAAAAGGAGAAGCAAAAGGG + Intergenic
1154478461 18:14791601-14791623 CAGAAAAAAGAGAAGTGAAACGG + Intronic
1154965651 18:21353187-21353209 AAAAAAAAGAAGAAAGAAATGGG + Intronic
1154991892 18:21605365-21605387 CAGAAAAGGAACAAGGAAATGGG - Intergenic
1155530050 18:26757936-26757958 CTGACAAAGGAGAAGGAAAATGG - Intergenic
1155632684 18:27912558-27912580 TAGAAAAAGGAGAATGAATGAGG - Intergenic
1155661806 18:28258141-28258163 CAGAACAAGTAAAAGGCAATGGG + Intergenic
1155839356 18:30627836-30627858 ATGAAAAAGCTGAAGGAAATAGG - Intergenic
1155880367 18:31140503-31140525 AAGAAAAATGAGAAGAAAAATGG - Intronic
1155952817 18:31931894-31931916 CAGTAAAAGGAAAAAGAAAGGGG + Intronic
1156110354 18:33718800-33718822 TAGAAAATGGAGGAGGTAATGGG - Intronic
1156145743 18:34175162-34175184 CAGAGAAAGGAGAATGGAACTGG + Intronic
1156291044 18:35748731-35748753 AAGAAAGAGGAAAAGGAGATGGG - Intergenic
1156488334 18:37480867-37480889 GAAAGAAAGGAGGAGGAAATGGG + Intronic
1156658236 18:39312993-39313015 AAGAAAATGGGGAGGGAAATTGG + Intergenic
1156729239 18:40170372-40170394 CAGAAGAAGGAGAAGAAAAAAGG + Intergenic
1156747621 18:40411597-40411619 CACATAAAGGAGCAGGAATTTGG - Intergenic
1156802919 18:41139938-41139960 CAGAAAAAGCAAAAGAAAATGGG + Intergenic
1156807712 18:41206325-41206347 CAGAAATATGGGAATGAAATAGG + Intergenic
1156948146 18:42860309-42860331 GAGAAGAAGGAGATGGGAATGGG + Intronic
1157006925 18:43594289-43594311 TAGAAAAAGAGGAAGGAAAATGG - Intergenic
1157060214 18:44279248-44279270 CAGGAAAAGAACAAGGAAAAAGG + Intergenic
1157321620 18:46639252-46639274 AAGAAAAAGGATAGGAAAATGGG + Intronic
1157385552 18:47257121-47257143 GAGAAAGTGGAGTAGGAAATTGG + Intergenic
1157407165 18:47431584-47431606 CAGCAAAAGGAGAAAGACAAAGG - Intergenic
1157558193 18:48627346-48627368 CAATAGAGGGAGAAGGAAATGGG + Intronic
1157638607 18:49188411-49188433 CAGACAATGGAAAAGGAAAATGG + Intronic
1157663725 18:49467981-49468003 GAGAAAAAGGCTAAGGAAAGCGG - Intergenic
1157764012 18:50284173-50284195 TGGCAAAAGGAGAAGTAAATAGG + Intronic
1157894004 18:51447179-51447201 GAGCAAAAGGAGAAGGAAAGAGG + Intergenic
1158133053 18:54174309-54174331 GAGAAAAAGGATAGGGAAATAGG + Intronic
1158151689 18:54381188-54381210 CAAAAAAAGAAAAAGGAAATGGG - Exonic
1158249651 18:55473335-55473357 AAGAAAAAGGAGAAAGCAAGAGG - Intronic
1158286132 18:55885380-55885402 CAGAAAATAGTGAAGGAAATGGG + Intergenic
1158288533 18:55912709-55912731 CAGAGAAAGGAGAAAGGAAAGGG - Intergenic
1158728058 18:59992921-59992943 CTGTAAAATGAGAGGGAAATGGG - Intergenic
1159156465 18:64589546-64589568 CAGAGAAAGAGGAAGTAAATGGG + Intergenic
1159549304 18:69878030-69878052 AATAAAAAGGAAAAGCAAATGGG + Intronic
1159820449 18:73134953-73134975 CAGAAGAAAAAGAAGGAAGTGGG - Intergenic
1159952064 18:74491895-74491917 CAGAAAATGTAGATGGAAGTGGG + Intergenic
1160002047 18:75033864-75033886 CAGGGAAAGGAGAAGGGAAGAGG - Intronic
1160099244 18:75904873-75904895 CAAGCAAAGGAGAAGGAAACAGG + Intergenic
1160131737 18:76231431-76231453 CAGACTAATCAGAAGGAAATGGG - Intergenic
1160235963 18:77087381-77087403 CAGAAAAAAAAGAAAAAAATGGG - Intronic
1160734565 19:656645-656667 CAGAAAAAGAAAAAGAAAAAGGG + Intronic
1161053463 19:2177754-2177776 AAAAAAAAGGAAAAAGAAATAGG - Intronic
1161094681 19:2383356-2383378 AAAAAAAAGGAGAAGTTAATTGG + Intergenic
1161128088 19:2571386-2571408 CAGAACAAGGATAAGGATATAGG - Intronic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1162176651 19:8834669-8834691 CAAAAAACAGAGAATGAAATTGG + Intronic
1162205704 19:9054705-9054727 CAGAAGAGAGAGAAGGAACTGGG - Intergenic
1162454900 19:10777584-10777606 AACAAAAAGGAAAAGGAAAAGGG - Intronic
1162870874 19:13585699-13585721 CAGAGAATGGAAAAGAAAATAGG + Intronic
1163028459 19:14528232-14528254 AAGAAAAAAGAAAAAGAAATGGG - Intronic
1163498715 19:17662929-17662951 AAAAAAAAGGAAAAGGAAAATGG + Intronic
1163652561 19:18526846-18526868 CAAAAAAAGAAAAAAGAAATAGG - Intergenic
1163900945 19:20099770-20099792 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1163983088 19:20920216-20920238 CAGAAAAAGCAGAATGGACTGGG + Intergenic
1164033461 19:21432437-21432459 CAGAAACAGGAGAACGGATTTGG + Intronic
1164168304 19:22701531-22701553 CAAATGAAGGAGAAGGAAGTAGG - Intergenic
1164250118 19:23468626-23468648 GAGAAAGAGGAGAGGGAAAAAGG - Intergenic
1164292311 19:23879573-23879595 GAGAAAAAGGAGAGGGAGGTGGG + Intergenic
1164631764 19:29766507-29766529 CAAAAAAAGAAGAAGGAAGAAGG - Intergenic
1164800675 19:31073653-31073675 GAGAAAGAGAAGAAGGAAAAAGG - Intergenic
1165020736 19:32922105-32922127 CACAAAAATGAGCAGGACATTGG + Intronic
1165117861 19:33539751-33539773 AAGAAAAAGAAAAAGAAAATTGG - Intergenic
1165165111 19:33848305-33848327 CAAAAGAAGTAGAAGGAAATAGG + Intergenic
1165736483 19:38179596-38179618 CAAAAAAGGGAGAAGGAAATAGG - Intronic
1165895718 19:39139708-39139730 CAGCCAAAGGATAAGGAGATTGG - Intronic
1165912192 19:39236494-39236516 AAAAAAAAGGAGAAGGGAAGGGG + Intergenic
1165922301 19:39307038-39307060 GAGAGAAAGGAGAGGCAAATAGG + Exonic
1166645449 19:44528220-44528242 AAGAAAAAGAAGAAAGAAAGAGG - Intronic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167228609 19:48267160-48267182 CAGAGAAAATAGAAGGGAATTGG + Intronic
1167238458 19:48329124-48329146 AAAAAAAAGAAAAAGGAAATTGG + Intronic
1167309238 19:48727411-48727433 CAGGAAAAGATTAAGGAAATTGG - Exonic
1167406122 19:49309919-49309941 AAGAAGAAGGAAAAAGAAATGGG - Intronic
1167428337 19:49441121-49441143 CAGAAAAAGGAACAGGATAATGG + Intronic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168635007 19:57989365-57989387 CTGGAAAACGAGAAGGAAAAAGG + Intronic
1168704443 19:58461244-58461266 AAGAAAAAGTAGAAGAAAATGGG - Intergenic
925034555 2:675802-675824 CAGGAAAGGGAGAAGGAACCAGG + Intronic
925515087 2:4673221-4673243 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
925738689 2:6986288-6986310 CAGAGTAGGGAGGAGGAAATCGG - Intronic
925757530 2:7148076-7148098 CAGAAAAAGGACAAGACCATGGG + Intergenic
925928913 2:8691962-8691984 CAGAAAAAGAAAAAGGGAGTAGG + Intergenic
926065587 2:9836997-9837019 AAGAAAAAGAAAAAAGAAATGGG - Intergenic
926127175 2:10278748-10278770 GAGGAAGAGGAGAAGGGAATTGG + Intergenic
926270054 2:11358747-11358769 AAAAAAAAGGAAAAGGAAAACGG + Intergenic
926276981 2:11411447-11411469 CAGAATAGTGAGAAGGAAAAGGG - Intergenic
926328167 2:11803230-11803252 CAGCAAAAGGAGAAGACAAAAGG - Intronic
926377857 2:12251790-12251812 AAGAAAAAGCATAAGAAAATAGG + Intergenic
926700307 2:15799076-15799098 AAGAAAGAGGAGAAAGAAAACGG + Intergenic
926719307 2:15947518-15947540 CAGAATAAACAGATGGAAATGGG + Intergenic
927120969 2:19962973-19962995 CGGTAAAGGGAGCAGGAAATGGG - Intronic
927301288 2:21518777-21518799 CAGAAAAATGAGCAGGCAACTGG - Intergenic
927345898 2:22039356-22039378 CAGAAAAAGAAGACAGAAAGAGG + Intergenic
927387347 2:22550228-22550250 AAGGAAAAGGAGAGGGAGATAGG + Intergenic
927558718 2:24053860-24053882 CAGATGAAGGAGTAGGATATTGG - Intronic
927789992 2:26002259-26002281 CAGACAAATGGGAAGGAAGTTGG - Intergenic
928019304 2:27689446-27689468 CAGCAAAGGGAGAAGGAACATGG + Intronic
928476556 2:31632828-31632850 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
928554424 2:32408619-32408641 TAGAAAAAGGGTAAGAAAATTGG - Intronic
928677414 2:33663225-33663247 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
928706650 2:33956880-33956902 AAAAAAAAGGACAAAGAAATGGG - Intergenic
929244605 2:39687520-39687542 ATGAAAAAGGTGCAGGAAATGGG - Intronic
929575067 2:43046352-43046374 CGGAAAGAGGAGGAGGAAACGGG + Intergenic
929717687 2:44329869-44329891 CACAAAAAAGATAAAGAAATTGG + Intronic
930044137 2:47154382-47154404 CAGAATAAGGAAAATGAGATGGG + Intronic
930158395 2:48128485-48128507 AAGAAAAGTGAGGAGGAAATGGG + Intergenic
930449034 2:51510979-51511001 AAGAAAAAGAAGAAGAAAAGTGG + Intergenic
930627287 2:53711775-53711797 AAAAAAAAGGAAAAAGAAATGGG + Intronic
930631649 2:53760177-53760199 TAGAATTAGGAGAAGGAAAAAGG + Intronic
930756336 2:54977268-54977290 CAGAAAAATTAGAAGGAAGTGGG - Intronic
930929940 2:56869023-56869045 CAAAAAAAGAAAAAGGAAAAAGG + Intergenic
931015138 2:57968713-57968735 CTGAATAATGAGAAAGAAATTGG + Intronic
931163791 2:59723254-59723276 CTGGAAAAGGAGGAGGAAGTAGG + Intergenic
931397711 2:61902553-61902575 TAGAAAATGGACAAGGAAATAGG + Intronic
931427107 2:62181234-62181256 CATATAAAAGTGAAGGAAATGGG + Intergenic
931647083 2:64433589-64433611 AAGCAAAAGAAGAAGCAAATGGG - Intergenic
931690172 2:64829066-64829088 GGGAAAAGGGAGAAGGAAGTAGG - Intergenic
931942609 2:67269088-67269110 AAAGAAAAGGAGAAGGAAAAAGG - Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932054157 2:68427876-68427898 CTCAAAAAGGTGAAGTAAATTGG + Intergenic
932555380 2:72819489-72819511 CAGAGAAAGGAGGAGGAGATAGG - Intronic
932659774 2:73642035-73642057 CAGAAAAAGGAAACAGAAAAAGG - Intronic
932777849 2:74539174-74539196 CGCAAAAAGGAGAAGGAAGTTGG + Intronic
933174929 2:79164399-79164421 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
933502258 2:83128861-83128883 AATAAAAAAGAGAAGAAAATTGG - Intergenic
933580861 2:84125568-84125590 AAGAAGAAGAAGAAGGAAAGTGG + Intergenic
934475306 2:94589504-94589526 CAGAGCAAGGAGAGGGGAATTGG - Intronic
934671772 2:96218397-96218419 CAGAATTAGGAGAAGAAAAAAGG - Intergenic
934677177 2:96257912-96257934 CAAAAAAAAAAGTAGGAAATGGG + Intronic
934852588 2:97710906-97710928 CTGAAAGAGGACTAGGAAATAGG + Intergenic
935070175 2:99687140-99687162 CAGAACAAAGAGAAGGATCTAGG + Intronic
935111678 2:100099799-100099821 AAGAAAAAAGAGAAAGAAAGAGG + Intronic
935238513 2:101157881-101157903 AAGGAAAAGGAGAGAGAAATGGG + Intronic
935240493 2:101173935-101173957 CAAGAAAAAGGGAAGGAAATGGG + Intronic
935246806 2:101225909-101225931 AAGAAAAAAGAAAAAGAAATTGG - Intronic
935274806 2:101466912-101466934 GAGGACAAGGAGGAGGAAATTGG + Intronic
935383370 2:102476665-102476687 AAGAAGGAGGAGAAGGAAAACGG + Intronic
935436146 2:103035921-103035943 GAGAAAAAAAAGAAGAAAATAGG - Intergenic
935702906 2:105828213-105828235 CATAAAAGGAAGATGGAAATAGG + Intronic
935798631 2:106670463-106670485 CAGAAAGATGAGAAAAAAATGGG + Intergenic
936221396 2:110606096-110606118 AAGAAAAAAGAGAAAGAAAGAGG + Intergenic
936387197 2:112041035-112041057 TAGAATTAGGAGAAGGAAAATGG - Intergenic
936658476 2:114515723-114515745 CAGAAAAAGAAGAAGGAAAAGGG - Intronic
936709508 2:115115925-115115947 CAAAAAAAGCAGAAGGAAAGTGG + Intronic
936778327 2:116001245-116001267 CAGAAAAAAATGAAGGGAATGGG + Intergenic
937070674 2:119060870-119060892 CAAAAAAAGAAAAAAGAAATGGG + Intergenic
937157108 2:119728837-119728859 CAGACAAAAAAGAAGAAAATTGG - Intergenic
937382092 2:121387655-121387677 CTGAAAGAGGACAAGGAAACGGG + Intronic
937403606 2:121607338-121607360 CAAAAAAAGAGAAAGGAAATAGG + Intronic
937629990 2:124090680-124090702 TAAAAAAAGAAGAAGGAAGTAGG + Intronic
937817246 2:126264728-126264750 AAGAAAAAAGAAAAGGAAAAAGG + Intergenic
937911504 2:127077879-127077901 CACAAGAATGAGAAGGAAACGGG + Intronic
937943741 2:127311878-127311900 AAGAAAAAAGAAAAGGAGATTGG - Intronic
938143808 2:128817701-128817723 CAGAAAATAGAGAAAGAAACCGG - Intergenic
938192709 2:129298017-129298039 TAGTAAAAGGAGGAGGGAATGGG + Intergenic
938367742 2:130748199-130748221 CAGATAAAGTTCAAGGAAATTGG + Intergenic
938512273 2:131962451-131962473 AAGAAAGAGAAGAAGGAAACAGG + Intergenic
938618948 2:133029759-133029781 CACAAAAAAGAAAAGGAAATTGG + Intronic
938941123 2:136170479-136170501 CAGAAAGGGGAGAAGGAGATTGG + Intergenic
939161219 2:138591955-138591977 TAGATAAAGGAAATGGAAATAGG - Intergenic
939534288 2:143406895-143406917 CAGCTAAAGGAAAAGGAAAGGGG + Intronic
939560046 2:143721201-143721223 AAGAAACAGGAGGAGGAAAGAGG + Intronic
939669145 2:144988251-144988273 CAGAAAAAGAGAAAGAAAATAGG - Intergenic
940141049 2:150490889-150490911 GAGAAAAAGGAGAGAGTAATAGG - Intronic
940309708 2:152264856-152264878 AAAAAAAAAGAGAAGAAAATCGG + Intergenic
940419347 2:153461274-153461296 CAAAAAATGGAGAAGAAATTTGG + Intergenic
940557448 2:155248683-155248705 AGGAGAAAGGAGAAGGAAAGAGG + Intergenic
940579801 2:155564104-155564126 CAGAAGAAAGAGAGGGAAAAAGG + Intergenic
940818318 2:158321633-158321655 CAGAAGAAAGAGAGGGAAAGGGG - Intronic
940827349 2:158427867-158427889 CTGAAAAAAAAGAAGGAAGTGGG + Intronic
941052803 2:160754047-160754069 TAGAGAAAGGAGAATGGAATGGG - Intergenic
941242854 2:163062555-163062577 AAGAAAAATGAGTAGAAAATGGG - Intergenic
941311610 2:163939544-163939566 AAGATAAAAGAGAAGAAAATGGG + Intergenic
941561724 2:167054691-167054713 AAAAAAAAGGAAAAGGAAACAGG + Intronic
941798086 2:169623663-169623685 CAGAATAAGGACACTGAAATGGG - Intronic
941865615 2:170331388-170331410 GAGAAAAACAAGAAGGACATTGG + Intronic
941988059 2:171527679-171527701 CAGAAAAAGGAGGGAGAACTGGG - Intronic
941991457 2:171561242-171561264 CAGAATTAGAAGAAGGAAAAAGG - Intergenic
942166912 2:173250370-173250392 CACAGCAGGGAGAAGGAAATAGG + Intronic
942204303 2:173604241-173604263 AAAAAAAGAGAGAAGGAAATAGG + Intergenic
942300561 2:174557249-174557271 AAGACAAAGGAGAAGGGAACTGG + Intergenic
942471102 2:176261312-176261334 AAGAAAAAGAAAAAGGAAGTTGG + Intergenic
942574876 2:177352800-177352822 TACAAAAAGGAGAAGGAAACAGG + Intronic
942580321 2:177410469-177410491 TAGAATTAGGAGAAGGAAAAAGG - Intronic
942706100 2:178774367-178774389 CAGAAAATATAGAAGGAAAATGG - Exonic
942816596 2:180060106-180060128 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
943034484 2:182725206-182725228 GAGAAAAGGGAGAAGGAAGAGGG - Intronic
943180970 2:184540497-184540519 AAGAAAAAAGAGAAGAAAAAAGG + Intergenic
943563417 2:189490096-189490118 CAGAAAAAGGTGAACTTAATCGG - Intergenic
943570327 2:189566258-189566280 CAAAAAAAGGAGAACGATAAGGG + Intronic
943570626 2:189569519-189569541 GAGAAAAAGGAGGAGGATAAAGG - Intronic
943787918 2:191899490-191899512 CAAAAGAAGCAGAAGGAAAACGG + Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944039237 2:195335876-195335898 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
944089292 2:195887787-195887809 GAGGAAAATGACAAGGAAATGGG - Intronic
944099429 2:196007146-196007168 CAGAAAAATAAGAACAAAATTGG + Intronic
944245676 2:197528590-197528612 AAGAAAAAGAAAAAGAAAATTGG - Intronic
944329120 2:198445007-198445029 AAGAAAAACGAAAAGGAAAAAGG - Intronic
944395202 2:199258921-199258943 CAGAAAAAGGAGGGGAAAAAAGG + Intergenic
944400841 2:199324330-199324352 CAGAAAAAAAATAAGTAAATGGG + Intronic
944552945 2:200862565-200862587 CAGAAAAAGGAGTCGGCAAAGGG - Intronic
945198278 2:207257417-207257439 GAGCAGAAGGAAAAGGAAATAGG - Intergenic
945372657 2:209038551-209038573 AAGAAAAAAGGAAAGGAAATTGG - Intergenic
945372659 2:209038563-209038585 AAAAAAAAGGAGAAGAAAAAAGG - Intergenic
945582377 2:211611312-211611334 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
945594479 2:211774710-211774732 TACAAAAAGTAAAAGGAAATTGG - Intronic
945630703 2:212272338-212272360 CAGAAAGAGGAAAAATAAATGGG - Intronic
945874966 2:215268282-215268304 GAGAAAAAGAAAAAGGAAAAAGG - Intergenic
946059436 2:216929074-216929096 TAAAAAAAAGAGAAGAAAATTGG - Intergenic
946622578 2:221574491-221574513 CAGAAAAAGAAGACGAATATTGG + Intergenic
946632892 2:221690492-221690514 TAGAAAGAGGAGAAGGGAAGGGG - Intergenic
946823664 2:223655160-223655182 CAGAAAAGGGAGAAAGAATAGGG - Intergenic
946983885 2:225249562-225249584 CAGGAGAAGGAGAATGAACTGGG + Intergenic
947345840 2:229188358-229188380 GAGAAAAGAGAGAAGGAAAGGGG + Intronic
947367932 2:229415862-229415884 CAGAAGAAAGAGAATCAAATCGG - Intronic
947919970 2:233861726-233861748 TAGAGAAAGGACAAGGAACTTGG - Intergenic
948185153 2:236015148-236015170 AAGAAAAAAGAGGAGAAAATAGG - Intronic
948202693 2:236141431-236141453 GAGAAAAAGGAGCCGGGAATAGG + Intergenic
948317347 2:237038502-237038524 TAGAAAAATGAGAAGGCAAGGGG + Intergenic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948751811 2:240137447-240137469 GAGGGAAAGGAGAAGGAAAGGGG + Intergenic
948758631 2:240175278-240175300 TAGAAAAAGAAGAATGAAATCGG - Intergenic
1168741070 20:191928-191950 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1168748509 20:265472-265494 GAGGAAAAGGAGTAGGAAAAGGG + Intergenic
1168873190 20:1148364-1148386 CAGATGAAGCAAAAGGAAATAGG - Intronic
1168874154 20:1159064-1159086 AAAAAAAAGAAGAAGTAAATGGG + Intronic
1168974428 20:1953393-1953415 CAGAAAGAGGAGAATGAATGGGG - Intergenic
1169009833 20:2241298-2241320 AAGAAAAAAGAGAAAGAAAGAGG - Intergenic
1169098677 20:2926755-2926777 AAAAAAAAGGAAAAGGAAAAAGG - Intronic
1169185217 20:3610240-3610262 TAGAAAAAGAAGAATAAAATGGG + Intronic
1169237321 20:3941362-3941384 CACAAAGAGGGGAAGGAAAAGGG + Intronic
1169623254 20:7532024-7532046 GAGAGAAAGGAGAAGGAAACTGG + Intergenic
1169654051 20:7903002-7903024 CTGAAAAAGGAAAATGAAAGAGG + Intronic
1169673123 20:8126390-8126412 GAGATGACGGAGAAGGAAATAGG + Intergenic
1169717365 20:8635301-8635323 AAGGAAAAGGAAAAGGAAAAGGG + Intronic
1169891421 20:10456675-10456697 CTGAAAAAGAAGAATCAAATTGG - Intronic
1169898370 20:10528424-10528446 CAGATAAAGGAAAGGGAAAATGG - Intronic
1170009469 20:11705770-11705792 CAGAATGAGGAGAGGGAAATGGG + Intergenic
1170099060 20:12678718-12678740 AAAAAAAAAGAGAAGGTAATGGG - Intergenic
1170131624 20:13026786-13026808 CAGAAAAAGGGCATGGGAATTGG - Intronic
1170160606 20:13306540-13306562 CAGCAAATGGAGAAGGAGAAAGG + Intergenic
1170306354 20:14942441-14942463 AAGAAAAAGGAGGAGGAGAAAGG - Intronic
1170449815 20:16470996-16471018 CAGGAAAAGAAGAATCAAATGGG + Intronic
1170465231 20:16616862-16616884 AAGGAAAAAGAGAAGGAAAGAGG + Intergenic
1170549068 20:17460178-17460200 CAGGAAAAGGAGAAGCACAAAGG + Intronic
1170590875 20:17770978-17771000 AAAAAAAAGGAAAAGAAAATTGG + Intergenic
1170990454 20:21297306-21297328 CAAGAACAGGAAAAGGAAATAGG - Intergenic
1171260235 20:23725572-23725594 CAGAAAAAGAAGGTGGTAATTGG + Intergenic
1171269348 20:23801394-23801416 CAGAAAAAGAAGGTGGTAATTGG + Intergenic
1171469000 20:25354921-25354943 CAGAAAGAGAAGAAAGAGATAGG - Intronic
1172283367 20:33723624-33723646 CAGCTGAAGGAGAAGGAAAGAGG + Intergenic
1172538471 20:35692699-35692721 CAGAAAAAAGAAAAAAAAATGGG + Intronic
1172576042 20:36009529-36009551 AAGAAAAAGAAAAAGGAAACAGG + Intronic
1172754575 20:37274097-37274119 GAGGGAAAGGAGAAGGAAAGAGG + Intergenic
1172946975 20:38697247-38697269 CAGGAAAAGAAGCAGGAGATGGG + Intergenic
1172964449 20:38824467-38824489 CAGAAGGAGAAGAAGGAACTGGG - Intronic
1173175652 20:40762940-40762962 CAGCAAGAGGGGAGGGAAATGGG + Intergenic
1173482201 20:43411252-43411274 CATAAGCAGGAGAATGAAATTGG + Intergenic
1174016222 20:47490505-47490527 AAGAAAAAGAAAAAGAAAATGGG + Intergenic
1174108642 20:48181951-48181973 AAAAAAAAACAGAAGGAAATTGG + Intergenic
1174582104 20:51579385-51579407 CAGGGAAAGGGGAAGGACATTGG + Intergenic
1174583573 20:51590660-51590682 CAGACAAAGGAGAAGGCAAAGGG - Intergenic
1174709528 20:52690275-52690297 AAGAAAAAGGAGAAGGGGAAGGG - Intergenic
1174961950 20:55167578-55167600 CAGAGAGAGGAGGAGGAGATAGG + Intergenic
1174977446 20:55350977-55350999 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1175125876 20:56751030-56751052 AAGAAGAAGAAGAAGAAAATGGG + Intergenic
1176281938 20:64318252-64318274 CAGAGAAAGGAAAAGGAACCGGG + Intergenic
1176810203 21:13528865-13528887 CGGCAAAAGGAGAAGCAAAAGGG - Intergenic
1176902069 21:14454416-14454438 CACACACAGGACAAGGAAATGGG + Intergenic
1177244780 21:18509461-18509483 CAGAACCAGGAGGAGGTAATCGG + Intergenic
1177303227 21:19277502-19277524 GAGAAAAAGGAGCAGGTAAAAGG + Intergenic
1177552056 21:22635785-22635807 CAGGAAAAGGCAAAGGACATTGG + Intergenic
1177979192 21:27889474-27889496 AAGAAAGAGAAGAAGGAAACAGG - Intergenic
1178150824 21:29791489-29791511 AAGAAGAAGGAGAAGGGAAGTGG + Intronic
1178303791 21:31473673-31473695 GAGAAAAAGTAGCAGGAAAGGGG + Intronic
1178579451 21:33825635-33825657 CATAAAAAGAACAAGGCAATTGG - Intronic
1178744986 21:35240346-35240368 CAGAAAAAGCAAAAGAAAAAGGG + Intronic
1178769630 21:35490997-35491019 CAGAAATGGGAGAATGAAACAGG + Intronic
1178948159 21:36965641-36965663 CAGAAGATGGAGAGGGAAAAGGG + Intronic
1179125454 21:38586793-38586815 AAGAAAATGGAAAATGAAATCGG + Intronic
1179157750 21:38864642-38864664 AAGAAAAGGGAGAGAGAAATAGG - Intergenic
1179258809 21:39740488-39740510 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1179287202 21:39987755-39987777 CTCAGCAAGGAGAAGGAAATAGG + Intergenic
1179288671 21:39999458-39999480 CAGAGAAAGATGAAGGAAATTGG + Intergenic
1179510322 21:41868674-41868696 AAGAAAAAGAAAAAGGAAAATGG - Intronic
1179530493 21:42015336-42015358 AAGAAAAAAGAGAAGAGAATGGG + Intergenic
1179768476 21:43594249-43594271 CAGAAAAAGGAAAATGACGTTGG + Intronic
1179773074 21:43638856-43638878 CTGAAAAAGAGGAATGAAATGGG + Intronic
1180591963 22:16947247-16947269 CAGTCAAATGAGATGGAAATAGG - Intergenic
1180747166 22:18097638-18097660 TATAAAAAGGAGAAGAAACTAGG - Exonic
1181131691 22:20735851-20735873 CAGACAAGGGAGAAAAAAATGGG + Intronic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1181785367 22:25222753-25222775 CATAAAAAGTAAAAAGAAATAGG + Intronic
1181796445 22:25315004-25315026 CAAAAAAAAGAAAAGGAAATGGG + Intergenic
1181817284 22:25448104-25448126 CAGAATGAGAAGAAGGAAAGCGG + Intergenic
1182325453 22:29509291-29509313 AAGAAAAAAGAAAAAGAAATGGG + Intronic
1182760897 22:32721520-32721542 AAAATAAAGGAGAATGAAATGGG - Intronic
1182936306 22:34225332-34225354 CAGTGAGAGGAGAAGAAAATAGG + Intergenic
1183438051 22:37806697-37806719 AACAAAAATGAGAAGGAAACTGG - Exonic
1183795724 22:40115727-40115749 AAGGAAAAGGGGAAGGGAATAGG + Intronic
1183963940 22:41429987-41430009 CAAAAAAAGAGGAAGAAAATAGG - Intergenic
1184437545 22:44488760-44488782 AAGGAAAAGGAAAAGGAAAGGGG + Intergenic
1184857372 22:47153751-47153773 GAGAAGAAGGAGAAGAAACTGGG + Intronic
1184883682 22:47328828-47328850 GAGAAAAAGGAAAAGGAAAGAGG - Intergenic
1185230835 22:49680506-49680528 CTAAAAAAGAAGAAGGAAGTTGG - Intergenic
1185319782 22:50195228-50195250 CAGGCAAGGGAGGAGGAAATGGG + Intronic
949513845 3:4789481-4789503 TAGAAAAATGAGGATGAAATGGG - Intronic
949520046 3:4843153-4843175 CTGCTAAAGGAGAAGGAATTGGG - Intronic
949567239 3:5256265-5256287 GAGAAAAAAGAGAAGGAGAAGGG - Intergenic
949573791 3:5319304-5319326 AAGAAAATTGAGAAGGGAATTGG + Intergenic
949881236 3:8662579-8662601 ATGAAAAAGGAGAAGGAACAAGG + Intronic
950275751 3:11659282-11659304 CAGAAAAAAAAAAAGAAAATAGG - Intronic
950283962 3:11730432-11730454 AAGAAAAAGAAAAAAGAAATTGG + Intergenic
950577265 3:13839699-13839721 GAGAAAAAGAAGGAGGAATTTGG - Intronic
950850176 3:16054747-16054769 CAGATAAAGGAGAAAGAAAATGG - Intergenic
950986728 3:17379079-17379101 AAAAAAAAGGAGCAGAAAATAGG - Intronic
951050821 3:18090650-18090672 TACAAAAAGGGAAAGGAAATAGG + Intronic
951083758 3:18485647-18485669 CAGAAAAAGGTGAGAGAAAGTGG + Intergenic
951226938 3:20131313-20131335 CAGTAAAAAGATCAGGAAATTGG - Intronic
951335853 3:21420889-21420911 CAGACAATGCAGAGGGAAATAGG + Exonic
951367913 3:21806980-21807002 CAGAAAAATAAGAGGGAAGTTGG - Intronic
951387372 3:22059023-22059045 GAGGAAAAGGAAAAGGACATTGG + Intronic
951387571 3:22061347-22061369 CAGGAAAAGTAGAAAGAAATGGG - Intronic
951406430 3:22305217-22305239 GATAAATAGGAGAAAGAAATAGG - Intronic
951618554 3:24575667-24575689 CAGGAAAAGAAAAAGGAGATTGG + Intergenic
951636716 3:24786814-24786836 CAGTAAAGGGAGAAGGAAACAGG - Intergenic
951777554 3:26326183-26326205 CAGTAACAGGCGAAGGAATTAGG + Intergenic
951781207 3:26364685-26364707 CAAAACAGGGAGAAGGAAAAAGG - Intergenic
952108434 3:30095208-30095230 TAGAAAAATGAGCAGGAGATAGG + Intergenic
952143369 3:30503917-30503939 CAAAAAAAAGAAAAGAAAATGGG - Intergenic
952276894 3:31886023-31886045 GAAAGAAAGGAGAAGGAGATGGG + Intronic
952550776 3:34474004-34474026 GAGAAAAAGCAAAAGGATATTGG - Intergenic
952992064 3:38839326-38839348 CAGAAAAAGAAGAAAAAAGTTGG - Intergenic
953097594 3:39793919-39793941 CAGAAAGATAAGAAGGAAAAGGG + Intergenic
953201925 3:40785605-40785627 GAGAAGAAGGAGAGGGGAATGGG - Intergenic
953270569 3:41438988-41439010 AAAAAAAAGGAAAAAGAAATAGG + Intronic
953604746 3:44404433-44404455 CAGAAAAAGGCTAAGGAAGCAGG - Intronic
953764385 3:45725127-45725149 TTGCAAAAGGAGAAGGAAGTTGG - Intronic
954067146 3:48115942-48115964 GAGAAAAAGGAGAAAAAAAAGGG - Intergenic
954407556 3:50353910-50353932 CAGAGAAAGGGGAAGGAAATGGG - Exonic
954994564 3:54869905-54869927 CAGATGAAGGGGAAGGAAAGTGG - Intronic
955062831 3:55507938-55507960 AAGAAAAGGGAGAAAGAAAAAGG + Intergenic
955092682 3:55768045-55768067 CAGAAAAAGGAGGAAGAGAGTGG - Intronic
955273003 3:57520398-57520420 AATAAAAAGGAAAAGAAAATGGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955443578 3:58983033-58983055 CAGAAAAAGGAGAGCCAAAGTGG + Intronic
956090840 3:65665282-65665304 CAGAAAAAGAAAACGGAAATTGG + Intronic
956292096 3:67671593-67671615 GAGAAAACAGAGAAGAAAATAGG - Intergenic
956390081 3:68762445-68762467 CTGAATAGGTAGAAGGAAATGGG + Intronic
956430133 3:69178169-69178191 CAGAAACAGGAAATGGAAAAAGG - Intronic
956518027 3:70072083-70072105 GAGAGAAAGGAGAAAGAAAGAGG - Intergenic
956789662 3:72670780-72670802 CAGAAAAAGCAGGAGAGAATTGG + Intergenic
956846548 3:73188870-73188892 CAGGAGAAGGAGGAGGAAAGAGG - Intergenic
956999953 3:74874060-74874082 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
957280104 3:78139806-78139828 AAGAAAAAGGAAAAGAAAAGTGG + Intergenic
957337108 3:78845382-78845404 CAATAAAAGGAAAAGGAAAAAGG - Intronic
957549952 3:81691294-81691316 AAGAAAAAGGAGAACAAAAATGG + Intronic
957617024 3:82542939-82542961 CAGTAACTGAAGAAGGAAATGGG + Intergenic
957698024 3:83669062-83669084 AATAAAAAGGAGATTGAAATGGG - Intergenic
957716661 3:83936894-83936916 CAGAAAATGATGAAGAAAATGGG + Intergenic
957898141 3:86450248-86450270 CAGTGAAAAGATAAGGAAATGGG + Intergenic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958479506 3:94628537-94628559 CAGAAAGCTGAGAAGGAAGTAGG + Intergenic
958690230 3:97456413-97456435 TATAAAAATGAGAAAGAAATGGG - Intronic
958833548 3:99117670-99117692 AAGAAGGAGGAGAAGGAAAAAGG + Intergenic
959248367 3:103904963-103904985 CAGAAAAAGGAAAAGTAAGAAGG + Intergenic
959349334 3:105241033-105241055 GACAAATAGGAGAAAGAAATGGG + Intergenic
959410965 3:106020699-106020721 CATAAAAAGGAAGAGGGAATGGG + Intergenic
959769443 3:110074849-110074871 TTGAAGAAGGATAAGGAAATGGG - Intergenic
959848859 3:111064811-111064833 CAGAACATAGAGAAGAAAATAGG - Intergenic
959903870 3:111689311-111689333 AAGTGACAGGAGAAGGAAATGGG + Intronic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960016191 3:112890769-112890791 CAGAAGAAGTAAAATGAAATTGG - Intergenic
960306929 3:116073228-116073250 CAGAAAAAGAACTCGGAAATAGG - Intronic
960404761 3:117246134-117246156 CAGAAAAAGGAGAAATAAATGGG - Intergenic
960490933 3:118315724-118315746 AAGAAAAAGAAAAAGAAAATTGG + Intergenic
960496369 3:118380345-118380367 TAGAAAAAGGAAAAGGAAGGGGG + Intergenic
960530339 3:118757014-118757036 CTCAAAAAAGAGGAGGAAATTGG + Intergenic
960540064 3:118851904-118851926 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
960736007 3:120781477-120781499 TAGAGAAAGGAGAAAGAATTAGG - Exonic
961080254 3:124020888-124020910 AGGAAAAAGGAGAAAGAAAAAGG + Intergenic
961127324 3:124431522-124431544 TAGGAAAAAGAGTAGGAAATGGG + Intronic
961208263 3:125104819-125104841 TAGAAAAAGGGGAGGGAAAAAGG - Intronic
961566557 3:127768099-127768121 CACAAAAAGAAAAAGAAAATTGG + Intronic
961696008 3:128705162-128705184 CAAAAAAAGGAGATTGAAATAGG + Intergenic
961744803 3:129057751-129057773 CAGAAAAATCAGATGGTAATTGG + Intergenic
961854434 3:129855512-129855534 CAGAAAAAGGAGAAGAAATGAGG + Intronic
961936235 3:130586873-130586895 CAAAAATAGGAGGAGGAAAGAGG + Intronic
961972771 3:130987995-130988017 CAGAAAAAGAAGAATGAAAGAGG - Intronic
961996733 3:131253372-131253394 CAGAATTAGGAGAAAGAAAGAGG + Intronic
962265838 3:133943779-133943801 CAGAGGAAGGACAAGGAACTTGG - Intronic
962490396 3:135888131-135888153 GATAATAAGGAGAAGAAAATGGG + Intergenic
962580133 3:136790625-136790647 AAGAAAAAGAAAAAAGAAATGGG + Intergenic
962633199 3:137300779-137300801 TAGAAAACAGAGAAGGAGATGGG + Intergenic
962768314 3:138588047-138588069 CAAAAAAAAGAGAAAGAAACAGG + Intronic
962777110 3:138672070-138672092 GAGAAAAAGGAGAAAAAAAGTGG + Intronic
962968283 3:140374285-140374307 GAAAAAAAGGAGGAGGAGATGGG - Intronic
963021550 3:140876787-140876809 CATCAAAAGGAGAAGGAGAGGGG + Intergenic
963162536 3:142166267-142166289 AAAAAAAAAGAGAAAGAAATAGG + Intronic
963188291 3:142442095-142442117 TAGAATTAGGAGAAGGAAAAAGG + Intronic
963224907 3:142852575-142852597 CTGAGGAAGGAGGAGGAAATGGG - Intronic
963295705 3:143544208-143544230 AAGAAAAAGAAAAAGAAAATTGG - Intronic
963635410 3:147788805-147788827 CAGAAAAAGGAGAAACTAATAGG - Intergenic
963693821 3:148539462-148539484 AATAAAAATTAGAAGGAAATGGG + Intergenic
963708850 3:148722742-148722764 CAGAAAACAGAGACGGAAAATGG - Intronic
963814614 3:149815524-149815546 CATAAAAAGGGGAAGAAAGTTGG + Intronic
963916090 3:150860092-150860114 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
964073357 3:152663239-152663261 CAGAACAAAGAGAAGGTAAGAGG + Intergenic
964346971 3:155763754-155763776 TAAAAAAAGGAGAAGGAATATGG - Exonic
964450506 3:156808183-156808205 CAAAAAAAAGAGAAGGGAAGGGG + Intergenic
964521333 3:157572316-157572338 CAGAAAAAGGAAAGAGAGATTGG + Intronic
964565347 3:158044796-158044818 CAGAAAATGGAAAAGGTAAGTGG + Intergenic
964822568 3:160788432-160788454 CAGAAAAAGAACAATGCAATAGG - Intronic
964930005 3:162007110-162007132 CAAAAGAAGGAAAAAGAAATGGG - Intergenic
965002435 3:162971710-162971732 CAAAAAGAAAAGAAGGAAATTGG - Intergenic
965054470 3:163696144-163696166 TAGAATTAGGAGAAGGAAAGAGG - Intergenic
965136502 3:164778311-164778333 CAGAAAAAAGGGAAAGAAAGAGG + Intergenic
965437036 3:168665255-168665277 CAGAAAAAGCAGAAGATATTAGG + Intergenic
965545833 3:169915501-169915523 AGGAAAAAGGAGAAGGAAAAAGG - Intronic
965825269 3:172723294-172723316 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
966016546 3:175146284-175146306 CAGAAAAAAGAGAAGGACTGTGG + Intronic
966088403 3:176099982-176100004 CAGAGAAAGAAAAAAGAAATTGG + Intergenic
966143254 3:176780978-176781000 CAGACAAAACAGAAGGAAATGGG + Intergenic
966326118 3:178756752-178756774 CAGAGAAAGAAAGAGGAAATTGG - Intronic
966353891 3:179058902-179058924 TAGAATTAGGAGAAGGAAAAAGG + Intronic
966398555 3:179525088-179525110 GAGAGAAAGAAGAAGGATATCGG + Intergenic
966659699 3:182400610-182400632 GAGAAGAAGGACAAAGAAATCGG + Intergenic
966671159 3:182527665-182527687 CAGAAAAAAGAAAAGAAAAATGG - Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966756975 3:183380398-183380420 CAATAAAAGGAAAAAGAAATAGG - Intronic
966770409 3:183498981-183499003 CAGAAAAAGAAGAGGGAAAGTGG - Intronic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
967127643 3:186438635-186438657 CACAAAAAGAAGAAAGAAAATGG - Intergenic
967623878 3:191664339-191664361 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
967769110 3:193314366-193314388 CAGAATATGGAGAGGGAGATGGG - Intronic
967896896 3:194402559-194402581 AAAAAAAAAAAGAAGGAAATGGG + Intergenic
968027756 3:195456808-195456830 AAGAAAAAGAAAAAGAAAATAGG - Intergenic
968282827 3:197490058-197490080 CAGAAAAAGTAGAGGGAGCTGGG - Intergenic
968391065 4:193451-193473 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
968737944 4:2308108-2308130 AAGAAGAAGAAGAAGAAAATTGG - Intronic
969154815 4:5201269-5201291 CAGAAACAGGAGAAGGGACAAGG - Intronic
969356546 4:6630684-6630706 GAGAAAAAAGAGAATAAAATAGG - Intergenic
970064656 4:12078866-12078888 AATAAAAAGGAAAATGAAATAGG - Intergenic
970110100 4:12628235-12628257 TAGTAAAGGGAGAAGGAAAAAGG - Intergenic
970153725 4:13119192-13119214 AAGAAAAAGCAGAATAAAATGGG - Intergenic
970334387 4:15019714-15019736 ATGAAAAAGGAGAAGGGAGTTGG + Intronic
970351949 4:15210144-15210166 CAGAAAAAGGTCAAGCAAGTGGG + Intergenic
970368755 4:15387137-15387159 CAGGAAAAGGAGAATCAAAGGGG + Intronic
970421928 4:15913014-15913036 AGGAAGCAGGAGAAGGAAATTGG + Intergenic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
970468423 4:16351221-16351243 AAGGAAAAGCAGAGGGAAATTGG - Intergenic
970534460 4:17015668-17015690 CTGAAAAAGAAGAACAAAATTGG - Intergenic
970832200 4:20353724-20353746 CACAAAAAAGAGTGGGAAATAGG - Intronic
970838052 4:20434493-20434515 AAGAAAAAGAAGAAGAAAATGGG + Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
970892958 4:21068188-21068210 CAGAAAAAGGGAAAGAAATTGGG - Intronic
971030116 4:22627095-22627117 CAGAAAAAGGGAAAATAAATGGG - Intergenic
971142474 4:23939116-23939138 AAGGAAAAGAAGAAGGAAAAAGG + Intergenic
971274803 4:25185647-25185669 CAAAAAAAGAAAAAGAAAATAGG + Intronic
971303798 4:25463241-25463263 CAATAAGAGGAGAAGGAACTCGG + Intergenic
971671279 4:29561142-29561164 CAGAAAAAAAAAAAAGAAATAGG - Intergenic
971951366 4:33352155-33352177 AATAAAAAGGAGAATAAAATTGG + Intergenic
972451405 4:39203088-39203110 AAGAAAAAGAAAAAGGAAAAAGG - Intronic
972580823 4:40394323-40394345 AAGAAAAAGAAAAAGAAAATAGG + Intergenic
972781025 4:42287039-42287061 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
973048856 4:45569920-45569942 GAGAAAGAGGAGAATTAAATTGG - Intergenic
973632189 4:52829967-52829989 GAGAAAAAGGAGAAAGGAAGAGG - Intergenic
974348443 4:60713329-60713351 CAGTGAAAGGAAAAGGAAACAGG + Intergenic
974483016 4:62470349-62470371 CTGAAAAAAGAGAAGGGAAGGGG - Intergenic
974525564 4:63046110-63046132 CAGAAAAAGTAGAAAGAGATGGG - Intergenic
975035562 4:69675587-69675609 AAGATAAAGGACATGGAAATTGG + Intergenic
975220856 4:71810977-71810999 CACACAATTGAGAAGGAAATGGG - Intergenic
975267663 4:72390008-72390030 CAGGAAAAGGAGAGGGGAAGCGG + Intronic
975397694 4:73896072-73896094 CAGAAAGAAGAGAAGAAAACAGG + Intergenic
975770198 4:77712033-77712055 AAGACAAAGAAGAATGAAATAGG - Intergenic
975929555 4:79502747-79502769 TAGAAAAAGTAGAATAAAATGGG + Intergenic
975930400 4:79514790-79514812 CACAAAAAGGAGCAGTAACTAGG - Intergenic
975941174 4:79648642-79648664 CTGAAAAATGAGTAGGAATTAGG + Intergenic
975948987 4:79745064-79745086 TAGGAAGAGGAGAAGGAAGTGGG - Intergenic
976052191 4:81022360-81022382 CAGACAGGGGAGAAGGAAAGAGG + Intergenic
976129324 4:81867899-81867921 CACAAAGAGGAGACAGAAATGGG - Intronic
976388898 4:84489571-84489593 CCTAAAAAGGAAAAGGCAATGGG - Intergenic
976464623 4:85353355-85353377 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
976777202 4:88719682-88719704 GAGAAGAAGGAGAAGAAAAAAGG - Intergenic
977251757 4:94696079-94696101 CAGAAAAAGAAGAAATAACTTGG - Intergenic
977277084 4:94991164-94991186 CAGTAGAAGGAGAATGAAAAAGG - Intronic
977346005 4:95817006-95817028 CATAAAAAAGAGAAGAAAACTGG - Intergenic
977531087 4:98200989-98201011 AAGAAAAAGAAAAAGAAAATAGG + Intergenic
977534176 4:98237795-98237817 CAGAAAAGGGTGAAGGAAGAAGG + Intergenic
977617904 4:99105995-99106017 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
977679263 4:99780905-99780927 GGGAAAAAGAAGAAGAAAATAGG - Intergenic
978220182 4:106262771-106262793 AGGGAAAAGGAGAAGGAAACTGG - Intronic
978247531 4:106592545-106592567 CAGAAATAGGAAAAGGTAGTTGG + Intergenic
978421737 4:108540911-108540933 CAATAAGTGGAGAAGGAAATGGG + Intergenic
978472538 4:109085693-109085715 CAAAGGGAGGAGAAGGAAATAGG - Intronic
978576093 4:110191405-110191427 AAGATAAATGAGAAGTAAATGGG + Intronic
978586465 4:110280433-110280455 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
978830147 4:113073974-113073996 CTGAAAAAGGAAAAGTAAATTGG + Intronic
979109503 4:116734158-116734180 GAGAGAAAGAAGAAGGAAATGGG + Intergenic
979456832 4:120935407-120935429 CAGGAAAAGGGAAAGGAAATAGG - Intergenic
979513753 4:121583345-121583367 CAGAATCAGGGAAAGGAAATCGG - Intergenic
979663957 4:123290392-123290414 CATACACAGGAGAATGAAATTGG - Intronic
979823112 4:125198633-125198655 CAGCAAAAGAAGAAGGAAGTGGG - Intergenic
980090706 4:128440489-128440511 TTGAAATATGAGAAGGAAATGGG - Intergenic
980113633 4:128658688-128658710 TAGAACAGGGAGAAGGAAAAGGG + Intergenic
980245523 4:130235102-130235124 CAGAAAAAGAGGAAAGAAAGGGG - Intergenic
980444553 4:132887889-132887911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
980559182 4:134450134-134450156 CAGATAAAGCAGCTGGAAATAGG - Intergenic
980619475 4:135279961-135279983 TAGAAAAAGGGGAAAAAAATAGG + Intergenic
980648505 4:135677940-135677962 TAGAAATAGCAGAAGGAAAATGG + Intergenic
980951753 4:139386113-139386135 CAGCTAAATGAGAGGGAAATAGG - Exonic
981006375 4:139879554-139879576 AAGAAAAAAGAGAAAGAAAATGG + Intronic
981133116 4:141180470-141180492 CAGATAATGGATAAGGGAATTGG + Intronic
981340084 4:143611531-143611553 CAGAAATATGAGAAGGAACAGGG + Intronic
981514012 4:145587715-145587737 GAGAAGAAGGAGAAGGGGATGGG + Intergenic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
981824876 4:148928553-148928575 CACAAAAAGTTGAAGGAATTGGG + Intergenic
982253524 4:153431214-153431236 CAGAAAAAGGAGTAGGTTGTAGG + Intergenic
982551042 4:156799591-156799613 AAGAAATAGGAGAATAAAATTGG - Intronic
982642101 4:157974880-157974902 CAGAGACAGGAAGAGGAAATGGG - Intergenic
982659074 4:158185275-158185297 GAAAGAAAGGAGAAGAAAATGGG + Intergenic
982744147 4:159089026-159089048 CAAAAAACAGAGAAGAAAATAGG + Intergenic
982975455 4:162051934-162051956 AAGAAAAACAAGAAGGAAATAGG + Intronic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983238079 4:165202630-165202652 ATGAAAAAAGAGAAGAAAATGGG + Intronic
984547798 4:181128245-181128267 CAGAAACTGGAAAAGGGAATAGG + Intergenic
984556301 4:181218307-181218329 CAGAAAAAAGATAAAGTAATAGG + Intergenic
984724064 4:183003154-183003176 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
985379634 4:189379087-189379109 CAGAAAAAGAAAAAGGTTATGGG + Intergenic
985386560 4:189453721-189453743 CTGAAGAAGGAGAAGGGAATTGG + Intergenic
985443744 4:190007027-190007049 CACAAGTAGGAGAATGAAATTGG - Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
986051457 5:4094284-4094306 GAGAACATGGAGAAGGAAATTGG + Intergenic
986067061 5:4245124-4245146 GAGAAGAAAGAGAAGGAAAACGG - Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986134549 5:4963008-4963030 CCGAAAAAGAAGAAGAAAGTTGG + Intergenic
986140542 5:5025963-5025985 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
986203895 5:5605115-5605137 CAGAGAAAGGTCAAGGAAGTGGG - Intergenic
986461822 5:7980356-7980378 CAGACACATGAGAAGGAAAAGGG - Intergenic
986634907 5:9811624-9811646 CAGAAGAAGAAGAAGAAAAAAGG - Intergenic
986775088 5:11006887-11006909 AAGAAACAGGAGGAGGAAAATGG + Intronic
987190887 5:15477204-15477226 GAGAAGAGGGAGAAGGAAAATGG - Intergenic
987503954 5:18746306-18746328 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
987642653 5:20632238-20632260 GAGAAAAATGAGAACAAAATAGG + Intergenic
987692125 5:21280914-21280936 CTTAAAAAAGAGAAGGAAAAAGG + Intergenic
988264845 5:28935349-28935371 CACAGAGAGGAGAAGGCAATCGG - Intergenic
988331809 5:29850953-29850975 AAGAAGGAGGAGAAGGAAAGAGG + Intergenic
988337986 5:29930864-29930886 GAGAAAAATGAGAAGGAAAAAGG - Intergenic
988404625 5:30808245-30808267 GAAAGAAAGGAGAAGGAAGTAGG + Intergenic
988426620 5:31072690-31072712 CAGAAATAGGAGAAGAAGAAGGG - Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
988952145 5:36274059-36274081 CAGAAAAAGGAAACAGAAAAAGG - Intronic
988956980 5:36329923-36329945 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
989065061 5:37452062-37452084 CAAAATAAAGAGAATGAAATTGG - Intronic
989232759 5:39104601-39104623 CAGAAAAGGCAGGAAGAAATGGG + Intergenic
989579865 5:43022152-43022174 CAGAAAAAAGAGAGAGAGATAGG + Intergenic
989705994 5:44331424-44331446 GAGAAAGAGGAAAAGGAAACTGG + Intronic
990021553 5:51133686-51133708 CAGAAACAGAAGAGTGAAATAGG + Intergenic
990130779 5:52580402-52580424 CAGAAAAAGGAGACAAAAAATGG + Intergenic
990206348 5:53433693-53433715 AAGAAAAAAGAGAAAGAAATGGG + Intergenic
990219770 5:53575080-53575102 GAGAGAAAAGAGAAGAAAATGGG + Intronic
990433344 5:55760424-55760446 CAGAAAAAAGAAAATGAACTTGG - Intronic
990778564 5:59331985-59332007 CAGAGAAAGGTAAATGAAATAGG - Intronic
990912860 5:60870727-60870749 CCAAAAAAGAAGAAGGAAAAAGG + Intergenic
990966107 5:61449807-61449829 AGGAACAAGGAGAAGCAAATGGG + Intronic
991263313 5:64689852-64689874 AAAAAAAAGGCAAAGGAAATAGG - Intergenic
991507400 5:67339556-67339578 AAGCAAAAGGAAAAGGAAAAGGG - Intergenic
991520812 5:67494882-67494904 AAGAAAAAGGAAAAAGAAAAAGG + Intergenic
991645812 5:68799442-68799464 CCTAAGAAGGTGAAGGAAATAGG + Intergenic
991713636 5:69431810-69431832 AAGAAGAAGAAGAAGAAAATGGG - Intronic
991748249 5:69769177-69769199 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
991799829 5:70349022-70349044 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
991828768 5:70661016-70661038 CTTAAAAAGGAGAAGGAAAAAGG + Intergenic
991892187 5:71348453-71348475 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
992578169 5:78141622-78141644 CAGATAATGGAGAAACAAATAGG - Intronic
992802196 5:80303742-80303764 AAGAAAAAGAAAAAGAAAATTGG + Intergenic
992955473 5:81903833-81903855 CAGAAAAATAAGAGGGAAAGGGG + Intergenic
993158810 5:84262302-84262324 AAGAAGAAGGAGAAAGGAATAGG + Intronic
993241474 5:85392785-85392807 AACAAAATGGAAAAGGAAATTGG + Intergenic
993765362 5:91849596-91849618 CAGAAAAAGGAAAAGCAAGATGG - Intergenic
993892363 5:93489938-93489960 CTGAAAAAGGAAAATGAAAGAGG + Intergenic
993900855 5:93583726-93583748 CAGAAGAAGGAGCAAGAAAGAGG + Exonic
994130839 5:96225893-96225915 AAGAAAAAGGAGAAGAAGAATGG - Intergenic
994153126 5:96473039-96473061 AAGAGAAAGGAGAGGGAAACTGG - Intergenic
994163898 5:96587585-96587607 CAGAAAGACCAGTAGGAAATGGG + Intronic
994364549 5:98897829-98897851 GAGAAAAAGGAGAGTGATATAGG - Intronic
994390512 5:99187033-99187055 AAGAAAAAGGAAAAGAAAACTGG - Intergenic
994934674 5:106239014-106239036 AAGAAAAAAGAGAAGGAAAAAGG + Intergenic
995227508 5:109718279-109718301 CAGAAAAAGGAAAAGAATAAAGG - Intronic
995277414 5:110292866-110292888 CTGAAAAAGGAGGTGGAAATGGG + Intronic
995345694 5:111114310-111114332 GAGAAAAATGAGAAGGAAGGTGG + Intronic
995465968 5:112449799-112449821 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
995714495 5:115068784-115068806 CAGAAAAAGGAGAAGAGGAGGGG - Intergenic
995860356 5:116634475-116634497 AAGAAAAAAGAAAAGGAAAAGGG + Intergenic
995884655 5:116880458-116880480 CAAAAAAAGGATGAAGAAATGGG + Intergenic
996030457 5:118699010-118699032 GAGAAAGAGAAGAAGGAAAGTGG + Intergenic
996047675 5:118893690-118893712 CAGAAAGAGGAGACTGAAAAAGG + Intronic
996109672 5:119550433-119550455 AAGCAAAAGGAGAAGGAAAAAGG + Intronic
996152408 5:120055997-120056019 AATAAAAAGTAGAAGGATATGGG + Intergenic
996195915 5:120606739-120606761 CAGAAAATGAAAAAAGAAATCGG + Intronic
996621696 5:125512650-125512672 AAGAAAAAAGAGAAAGAAAAAGG - Intergenic
996844589 5:127885187-127885209 CAGACAAAGCACAAGGGAATTGG + Intergenic
996849679 5:127938084-127938106 CAGGAGTAGGAGAAGGAAAATGG - Intergenic
997391388 5:133520092-133520114 CTGAGAAAGGAGAAGAAAAGAGG - Intronic
997439301 5:133898104-133898126 CAGAAAAAGGAGCTCGAACTTGG + Intergenic
997775929 5:136604993-136605015 CAGAAAAAGAGGAAGGAAGGTGG - Intergenic
998278826 5:140784632-140784654 TAGACAAAGGACCAGGAAATAGG - Intergenic
998505236 5:142667284-142667306 AAGAAAAAAGAGAAAGAAACAGG + Intronic
998786852 5:145720798-145720820 AAGAAAAGGGAGAGGGGAATTGG + Intronic
998966631 5:147548213-147548235 CAGCAGAATGAGAAAGAAATAGG + Intergenic
998994071 5:147851582-147851604 GGGAAAATGGAGTAGGAAATTGG + Intergenic
999110908 5:149120908-149120930 CAGAAAAAGAAGAAAGCAAGAGG + Intergenic
999350932 5:150871018-150871040 CAGAAAAAGGAAAACAAAAAAGG + Intronic
999393214 5:151209562-151209584 CAGAAGAAAAAGAAAGAAATTGG - Intronic
999508823 5:152226527-152226549 CTGAAAGAGGAGAAGAATATTGG + Intergenic
999667678 5:153931006-153931028 TAAAGAAAGGAAAAGGAAATAGG - Intergenic
999869134 5:155731096-155731118 AAGAAAAAGGAGAAAGACAGAGG + Intergenic
999954252 5:156683261-156683283 CAACAAAAGCAGAAGTAAATGGG - Intronic
1000012889 5:157249275-157249297 CAGAAAATCGAGAAGGAAGCTGG - Intronic
1000141885 5:158412860-158412882 CAGAGAAAGTAGAAGTAATTGGG - Intergenic
1000172665 5:158718398-158718420 CAAAAAAAGGGGAAGGCAAAAGG - Intronic
1000291539 5:159875788-159875810 CAGGGAAAGGAGAAGAAAAAGGG + Intergenic
1000330882 5:160204476-160204498 CTAAAAAAGGAAAAGAAAATAGG - Intronic
1000408355 5:160912652-160912674 GAGAAAAAAGAGAAGAAAAGAGG + Intergenic
1000451524 5:161394808-161394830 CAGAAAATAGAGAAGGAAGATGG + Intronic
1000745876 5:165032507-165032529 CAGCAAAAACAAAAGGAAATTGG + Intergenic
1000749505 5:165076096-165076118 TAGAAAATGGAGAAAGAATTTGG + Intergenic
1000865158 5:166504606-166504628 AAAAGAAAGGAGAAGGAGATTGG - Intergenic
1001148495 5:169205340-169205362 CAGAATAAGGAGAATAGAATAGG - Intronic
1001168625 5:169394827-169394849 TAGAGAAAGGAGTAGGAAATGGG + Intergenic
1001290495 5:170454664-170454686 AAGAAAAATGAGTAGGAAGTTGG + Intronic
1001492869 5:172168116-172168138 CAGAATAAAGACAGGGAAATAGG - Intronic
1001554438 5:172626355-172626377 CAGCAAGAGGAGAAGGAGAGAGG - Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1002477780 5:179478513-179478535 AAGAAAAGGAAGAAGGACATTGG + Intergenic
1002487138 5:179546940-179546962 AAGAAAAAGGAAAAGAAATTAGG - Intergenic
1003449845 6:6220333-6220355 CAGGAAAAGGGGAAGTAATTTGG + Intronic
1003745514 6:8997152-8997174 AAGGAAAAGGAGAAGGAGCTAGG + Intergenic
1004052877 6:12105815-12105837 CACAAAAAGAATAAGAAAATAGG - Intronic
1004086284 6:12452733-12452755 GAGAAAATGGAGGTGGAAATTGG - Intergenic
1004392975 6:15224713-15224735 CAAAAAAAAGAGAGAGAAATGGG - Intergenic
1004481874 6:16027783-16027805 GTGACAAAGTAGAAGGAAATAGG + Intergenic
1004628900 6:17402995-17403017 CATAATGAGGAGATGGAAATGGG - Intronic
1004705277 6:18118656-18118678 AGGGAGAAGGAGAAGGAAATAGG - Intergenic
1004742735 6:18477687-18477709 CCCAAAAAGGAGAAGGCATTTGG - Intergenic
1004860178 6:19796109-19796131 TAGAAAAAGGATAAGCAAAATGG + Intergenic
1004920239 6:20369329-20369351 CAGGAAAAGGAGAAGGATCAGGG + Intergenic
1005286277 6:24330481-24330503 CTTCAAAAGGAGAAGGAATTTGG + Intronic
1005700226 6:28393418-28393440 GAGAAAGAGGAAAAGGAAAGGGG + Intronic
1005750597 6:28878632-28878654 CAGAAATAAAAGAAGGAAAATGG + Intergenic
1005887295 6:30106597-30106619 GAAAAAAAAAAGAAGGAAATAGG + Intronic
1005984393 6:30861925-30861947 AAGAAAAAAGAAAAGAAAATAGG + Intergenic
1006555168 6:34859601-34859623 CAGAACTAGGAGAAGGAGATGGG - Intronic
1006564452 6:34942954-34942976 AAGGAAAAGGAAAAGGAAAGGGG - Intronic
1006942736 6:37763648-37763670 CACACCAAGGAGAAGGGAATCGG + Intergenic
1006947807 6:37797068-37797090 CAGACAAGGGAGAAGGCAAAAGG - Intergenic
1007004556 6:38348210-38348232 CAGAAAAAGCAGAAAGAGAGAGG - Intronic
1007111999 6:39318178-39318200 CCCAGAAGGGAGAAGGAAATCGG - Intronic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007365286 6:41387364-41387386 AAGAAAAAGGAGAAAGAATTTGG - Intergenic
1007377450 6:41466573-41466595 GAGGGAAAGGAGAAGGAGATAGG + Intergenic
1007535630 6:42585723-42585745 CATCAAAAGCAAAAGGAAATAGG - Intronic
1007559292 6:42792923-42792945 GAAAAAAAGGAGAAAGAAATTGG + Intronic
1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG + Intronic
1007667939 6:43527146-43527168 CAAAAATAGCAGAAGGAATTTGG - Intronic
1007756842 6:44104998-44105020 CAGAAAAAGCAGAAGAAATGTGG + Intergenic
1007846510 6:44762050-44762072 CAGAAAGAGGAGAATGCCATGGG + Intergenic
1008019985 6:46565485-46565507 CATAAAAAAAAGAAGAAAATGGG + Intronic
1008117619 6:47570497-47570519 AGGAAAAAGGAGGAGGAAAAAGG - Intronic
1008500150 6:52172681-52172703 AAGAAAGAAGAAAAGGAAATAGG + Intergenic
1008753446 6:54764983-54765005 GAGAAAAAGCAGAAGGACAGAGG - Intergenic
1008843726 6:55936521-55936543 AAGGAAAAAGAGAAGAAAATGGG + Intergenic
1008887264 6:56444683-56444705 AAAAAAAAGGAAAAGGAAAAAGG + Intergenic
1008982002 6:57494691-57494713 AATAAAAAGGAGATGGAAAAAGG + Intronic
1009170069 6:60387533-60387555 AATAAAAAGGAGATGGAAAAAGG + Intergenic
1009667132 6:66697470-66697492 GAGAAAGAGGAGAAGAAAGTTGG + Intergenic
1009990992 6:70842753-70842775 CAGAATGAGGAGAAGCAAAGAGG - Intronic
1010048307 6:71473289-71473311 GAGGAAAAGCAGAAAGAAATGGG - Intergenic
1010320344 6:74501085-74501107 CAGAAGAAGTAAAAGGATATGGG - Intergenic
1010539414 6:77072601-77072623 CAGAAAAAGGATGGGGGAATGGG + Intergenic
1010663003 6:78593064-78593086 CAAAAAAAAGAGAAAGTAATGGG - Intergenic
1010893788 6:81342933-81342955 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1010928393 6:81770981-81771003 CAGGGAAATGAGAAGGAAAGGGG + Intergenic
1010951691 6:82044459-82044481 CAGAAAAAGTAAAAGACAATGGG + Intergenic
1011077110 6:83449153-83449175 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1011204030 6:84872270-84872292 CACAAGAACGAGAAGGAAATGGG + Intergenic
1011742008 6:90371379-90371401 GAGAAAAAGGATCAGGAAATGGG - Intergenic
1012010538 6:93778951-93778973 CACAATAGGGAGAAGAAAATTGG - Intergenic
1012036834 6:94152612-94152634 CAGAAAAAGGAGAAAATAAGGGG - Intergenic
1012051948 6:94357880-94357902 GAGGAAATGGAGAAGGAAAAAGG - Intergenic
1012817069 6:104037525-104037547 GAGAAAAAGGAAAAGAAAAAGGG - Intergenic
1012933946 6:105346065-105346087 CAGAAAAACGAAAAAGAATTGGG - Intronic
1012946215 6:105468698-105468720 AAAAAAAAGAAGAAGGATATAGG - Intergenic
1012946464 6:105471409-105471431 GAGTAAAAGGAGAAAAAAATTGG - Intergenic
1013093406 6:106921605-106921627 AAGAAGAAGGAAAAGGAAAAGGG + Intergenic
1013139408 6:107316998-107317020 CAGAAAAAGTAAAAGCAACTAGG + Intronic
1013543880 6:111136848-111136870 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1013855141 6:114563409-114563431 TAGAAAAAGGAAAAGAAGATTGG - Intergenic
1014061582 6:117078139-117078161 AAGAAAAAGGAGAAATGAATGGG - Intergenic
1014087625 6:117365762-117365784 AAGAAATAGGAGAAAAAAATGGG + Intronic
1014126310 6:117780487-117780509 AAGAAAATGGAGAAAGACATTGG - Intergenic
1014298078 6:119644767-119644789 CAGTACAAGTAGAAGGAAAGTGG - Intergenic
1014494349 6:122102147-122102169 AAGAAAAAGGAAAAGAAAAGTGG + Intergenic
1014599666 6:123395200-123395222 AAGAAAAAGGAGAAGATAAGAGG - Intronic
1014607280 6:123492646-123492668 CACAAAATTGAAAAGGAAATTGG + Intronic
1014619630 6:123649969-123649991 AAGAAAAAAGAAAAGAAAATAGG + Intergenic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1014775751 6:125507647-125507669 CGGAAAAATGAGAAGTAAAATGG - Intergenic
1014817249 6:125949753-125949775 CAGAAAAAGGAGAAGCCAACAGG - Intergenic
1015274436 6:131369431-131369453 TAGGAAAAGGAGAAAGGAATAGG + Intergenic
1015292029 6:131548070-131548092 CAGAAAAAGGGGAAAGGAAGAGG + Intergenic
1015404460 6:132821502-132821524 AAGAAAGAGGAGGAGGAAAAGGG - Intergenic
1015582980 6:134746433-134746455 GAGATAAAGGAGAAGACAATTGG + Intergenic
1015865159 6:137720170-137720192 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1016003561 6:139066941-139066963 AAGGAAAAGGAAAAGGAAAAAGG - Intergenic
1016062922 6:139648765-139648787 CAGAAAAACGAGGAAGGAATAGG + Intergenic
1016441369 6:144087537-144087559 TAGAAAAAAGGGAAGGAAATTGG + Intergenic
1016624648 6:146152318-146152340 CAGAAAAGTAAGAAGGAAAGTGG - Intronic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1016969048 6:149745757-149745779 CAGAAAAAGGACTGGGAAAGGGG - Intronic
1016981958 6:149862563-149862585 AAAAAAAAGGAAAAGAAAATAGG - Intronic
1017037117 6:150276653-150276675 GAGAAAAAGGAGAAAGGAAACGG - Intergenic
1017091628 6:150764103-150764125 AAGAAAAAGAAAAAGAAAATAGG - Intronic
1017115046 6:150968188-150968210 CAGAAAACAGATAAGGAAATAGG - Intronic
1017216543 6:151914129-151914151 CAGAAGAAAAAGAAGAAAATTGG - Intronic
1017568239 6:155711655-155711677 CAGAAAATAGAGAATAAAATGGG - Intergenic
1017961103 6:159221474-159221496 CAGAAAGAGGAAACGGAAAAAGG + Intronic
1018159212 6:161021465-161021487 CAGAAAAAGGAGGCAGAAAGTGG - Intronic
1018168152 6:161119595-161119617 CTGAAAAAGAAGAACAAAATTGG - Intergenic
1018240914 6:161773821-161773843 CAGAAAAAGAAGAAGAAGAAGGG + Intronic
1018412294 6:163563344-163563366 CGGAAAAATGAGAAGGGAGTAGG - Intronic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1018602274 6:165557221-165557243 CAGAAGAAAGATAAGAAAATAGG + Intronic
1018789533 6:167136378-167136400 CAGATCAAGGAGTAGGCAATCGG - Exonic
1018816789 6:167338895-167338917 AAGAAAAAGAAGAAGGAAGAGGG - Intronic
1018921709 6:168180051-168180073 CAGAGAAAGGCGGAGGAAAGTGG + Intergenic
1019210760 6:170402641-170402663 CAGAAAAAGGAGGAGACAGTTGG + Intronic
1019340196 7:505266-505288 CGGAAAAAGGGGAGGGACATGGG - Intronic
1019484235 7:1281440-1281462 CAGAAAAAGTAAAAAGAAACAGG - Intergenic
1020395877 7:7717024-7717046 AAGAAAAAGGAAAAAGAAAGAGG - Intronic
1020508197 7:9019651-9019673 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1020585908 7:10066963-10066985 TAGAAAAAGGAGAACAAATTAGG + Intergenic
1020676318 7:11189051-11189073 CTTACAAAGGAAAAGGAAATGGG - Intergenic
1020765622 7:12316550-12316572 CAGAAACTGGGGAAGGTAATGGG + Intergenic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1020919441 7:14244142-14244164 CATAAAAAGGAGATCGAAAGTGG + Intronic
1020976845 7:15017128-15017150 GGGAAAAAGGAGAAAGAAAGAGG + Intergenic
1021049750 7:15968012-15968034 CAGAAGGAGGAGAAGGGAAGTGG - Intergenic
1021131483 7:16917640-16917662 CAAAGAAGGGAGAAAGAAATAGG - Intergenic
1021158857 7:17246846-17246868 GAGAAAAAGGAGAAGGTGAAAGG - Intergenic
1021183109 7:17531785-17531807 CAAAAAGAGCAGAAGGAAATGGG + Intergenic
1021211139 7:17853966-17853988 AAGAAAAAAGAAAAGAAAATTGG + Intronic
1021438399 7:20648792-20648814 CAGAAAAAAAATAAGGAAGTAGG - Intronic
1021839304 7:24709592-24709614 AAGGAAAAGGAGAAACAAATAGG - Intronic
1021979540 7:26040892-26040914 AAGAAAAAGAAAAAGAAAATAGG + Intergenic
1022287402 7:28967015-28967037 CAGAAAACAAAGAAAGAAATGGG + Intergenic
1022448126 7:30486747-30486769 CAGAAAAAAAAGAAAGAAAGTGG - Intergenic
1022806685 7:33829572-33829594 AGGAAAAAGGAGAAGGAAACAGG - Intergenic
1022827836 7:34034606-34034628 CAGAAAAAGGAAAGTGATATTGG - Intronic
1022901173 7:34811965-34811987 GAGAAGAAAGAGAAGGAAAGAGG - Intronic
1023018747 7:35990664-35990686 CAGAAAAAGAAGAACAAAATTGG + Intergenic
1023333157 7:39140578-39140600 CACACAAAGGATGAGGAAATAGG - Intronic
1023409450 7:39874864-39874886 CACAAAAATAAAAAGGAAATTGG - Intergenic
1023562861 7:41494087-41494109 CAGAAAAGGGAGATGTAATTAGG - Intergenic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1023732753 7:43208070-43208092 CAGAAACAGAAAAAGAAAATGGG - Intronic
1023800999 7:43834750-43834772 CAGGAAAAGGAAAAGGAAAAGGG - Intergenic
1024037207 7:45517434-45517456 CATAAAAAGGAGAACTGAATGGG + Intergenic
1024350980 7:48363714-48363736 CAGACAAAGGAGAATAAAATTGG - Intronic
1024382977 7:48721144-48721166 CAGACAAAGGAGGAGGTACTGGG + Intergenic
1024394172 7:48847200-48847222 CAGAAAACGGAGATTTAAATTGG - Intergenic
1024401065 7:48925214-48925236 CAGAAAACGGAGATTTAAATTGG + Intergenic
1024420090 7:49155762-49155784 CAAATATAGTAGAAGGAAATTGG + Intergenic
1024515247 7:50246229-50246251 CATCAAAAGCAAAAGGAAATAGG + Intergenic
1024731129 7:52254978-52255000 AAGAAAAAGGAGAAGAAAGAGGG + Intergenic
1025043480 7:55669158-55669180 CACAAAAATAAAAAGGAAATTGG + Intergenic
1025136401 7:56417671-56417693 CACAAAAATAAAAAGGAAATTGG + Intergenic
1025738599 7:64176889-64176911 CAGTAAAAAGAGATGAAAATTGG + Intronic
1025888288 7:65620424-65620446 CAGAACAAGGAGGTGGAAATGGG + Intergenic
1025931334 7:65997096-65997118 AAAAAAAAGAAGAAAGAAATGGG - Intergenic
1026105458 7:67417433-67417455 CAGAAGAAGGAGAGAGAAATGGG + Intergenic
1026260797 7:68753709-68753731 AAGAAAAAGAAAAAAGAAATAGG - Intergenic
1026262836 7:68770633-68770655 CAGAGAGAGAAGAAGGAAATAGG + Intergenic
1026321481 7:69271718-69271740 CAGAAAAAGAGGAAGGAAAAAGG - Intergenic
1026582839 7:71632423-71632445 CAAAGAAAGGAGAAGGCAGTAGG + Intronic
1027476207 7:78634471-78634493 CTGAAGAAGGAGAAAGCAATTGG + Intronic
1027505229 7:79009006-79009028 AAAAAAAAGGAGAAGGAAGAGGG - Intronic
1027833010 7:83204729-83204751 CTTCAAAAGGAGAAGAAAATGGG - Intergenic
1027926748 7:84474962-84474984 CTAAGAAAAGAGAAGGAAATAGG + Intronic
1027961601 7:84952861-84952883 GGGAAAAAAAAGAAGGAAATGGG + Intergenic
1028149869 7:87359308-87359330 GAGCAAAAGGAAAAAGAAATTGG + Exonic
1028182621 7:87744008-87744030 CACATGAAGGAGAATGAAATTGG - Intronic
1028397699 7:90390183-90390205 AAGAAAAAGCAAAATGAAATAGG + Exonic
1028534999 7:91881982-91882004 AAGAAAAAGGAGAAAGAAATGGG - Intergenic
1028553598 7:92099115-92099137 CAGATAAGGGTGAAGGAAAGTGG - Intronic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028696367 7:93717666-93717688 AAGAAAAAGAAGGAAGAAATGGG + Intronic
1028742311 7:94289673-94289695 AATAAAAAGGAGAAGAAGATAGG + Intergenic
1029542336 7:101191232-101191254 GAGAAAAAGGAGCAGGAGAGAGG + Intergenic
1030335176 7:108317944-108317966 AAGGAAAAGGAAAAGGAAAGGGG + Intronic
1030560461 7:111078658-111078680 CTCAAAAAGGATAAAGAAATGGG - Intronic
1030563966 7:111128214-111128236 CAGGAAAAAGAGAAATAAATAGG + Intronic
1030843170 7:114380318-114380340 TAGAATTAGGAGAAGGAAAATGG - Intronic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031406551 7:121394304-121394326 ATTAAAAAGGAAAAGGAAATTGG - Intronic
1031636639 7:124108894-124108916 CAGCAAAGGGAAAAGGACATGGG + Intergenic
1031746792 7:125508904-125508926 AAGAAAAAGGGGAATTAAATAGG + Intergenic
1031747249 7:125515863-125515885 CAGCAAAAGGATAAAGAAAATGG - Intergenic
1031752076 7:125588219-125588241 CAGAAAAATTAAAAGTAAATAGG - Intergenic
1031854146 7:126901542-126901564 CAGAACAAGGAGGTGGAAATGGG - Intronic
1031874486 7:127122972-127122994 CAGGAACAGGAGAAGAAGATGGG + Intronic
1032341502 7:131078238-131078260 CAGATGGAGGAGAGGGAAATGGG + Intergenic
1032417277 7:131745711-131745733 CAGAAACAAGAGAAAGAAATAGG + Intergenic
1032675017 7:134121851-134121873 CTGAAAGAGGAGAAGGAAGTGGG - Intergenic
1032689959 7:134275873-134275895 CACAAAAAGGACAAGGATATTGG + Intergenic
1032729745 7:134628175-134628197 CAACAAAAGAAGAAGTAAATTGG - Intergenic
1032730631 7:134638810-134638832 GAGAAAAAGGAGAAAAAAAAAGG - Intergenic
1032846939 7:135759132-135759154 CAGAAAAAAGAAAAGGGGATGGG - Intergenic
1033116834 7:138632740-138632762 AGGAAAAAGGAGGAGGAAAGAGG + Intronic
1033289160 7:140067612-140067634 CAATAACAGCAGAAGGAAATGGG + Intergenic
1033400587 7:141020038-141020060 CAGAAAAAGAAGAAGGGACTAGG + Intergenic
1033611785 7:142970295-142970317 CAGCAAAAGGAGCAGGAAAAGGG + Intergenic
1033652094 7:143351393-143351415 CAGAAAAAGGACAAGAAAAGGGG - Intronic
1033772809 7:144572254-144572276 CTGAAAAATGAGAGAGAAATAGG - Intronic
1033933152 7:146549050-146549072 CAAAAAAAAAAAAAGGAAATTGG - Intronic
1034016190 7:147589467-147589489 TAGCAAAGGGAGAAGGAAAGGGG - Intronic
1034109598 7:148523232-148523254 CATGAAAAGAAGAAGGAAAATGG + Intergenic
1034244608 7:149634940-149634962 CTGAAGAAGGAGGAGGAATTAGG + Intergenic
1034728607 7:153363894-153363916 GGGGAAAAGGTGAAGGAAATTGG - Intergenic
1034935776 7:155199728-155199750 CAGCAAAAAGTGAAGCAAATTGG + Intergenic
1035120495 7:156562811-156562833 CAGAATGAGGAAGAGGAAATTGG + Intergenic
1035521868 8:281074-281096 AAGAAGACGGAGAAGGAAAATGG + Intergenic
1035575900 8:704764-704786 AAGAAAAAGAAGAAGAAAACAGG + Intronic
1035896307 8:3406226-3406248 AAGAAAAAGAAGAAGAAAAAAGG + Intronic
1035928371 8:3754364-3754386 CAGAAAAAAGGAAAAGAAATAGG + Intronic
1035951629 8:4028499-4028521 CAAAAAAAGGAAAAAAAAATAGG + Intronic
1036062866 8:5344408-5344430 CAGAAAAAAGAGGAATAAATTGG + Intergenic
1036079041 8:5533415-5533437 CGGAAATAGGAGGAGGAAAGAGG + Intergenic
1036134395 8:6146529-6146551 CACAAAAAAGAGAAGTAAAAGGG + Intergenic
1036375056 8:8192850-8192872 CAAAAAAAAGAAAAGAAAATAGG + Intergenic
1036421691 8:8602087-8602109 CTGACAAAGGGGAAGGAAACAGG - Intergenic
1036469764 8:9042179-9042201 CACAGAAAAGAGAAGGAACTTGG + Intronic
1036562811 8:9911775-9911797 AAAAAAAAGGAGATGGAAAAAGG + Intergenic
1036628806 8:10496123-10496145 GAGAAGAAAGAGAAGGAAAAAGG + Intergenic
1036635112 8:10544793-10544815 AAAAAAGAGGAGGAGGAAATAGG - Intronic
1036751437 8:11445954-11445976 GTGAAAAAGGAGAAAGAAAGAGG + Intronic
1036854486 8:12230299-12230321 CAAAAAAAAGAAAAGAAAATAGG - Intergenic
1036875845 8:12472798-12472820 CAAAAAAAAGAAAAGAAAATAGG - Intergenic
1036992117 8:13609653-13609675 CAAAAACAGGAATAGGAAATTGG - Intergenic
1037124494 8:15330205-15330227 AAAAAAAAGAAGAAGGAAATTGG - Intergenic
1037189852 8:16110978-16111000 CAGAAGAAGGAAAAGAAAAAAGG + Intronic
1037217598 8:16476665-16476687 CAGAATAAGAAGAGGGAAAAGGG - Intronic
1037382352 8:18299990-18300012 CAAAAAAATGAAAAGAAAATCGG - Intergenic
1038153561 8:24964821-24964843 TAGAAAGAGGAGAAGCAAAATGG + Intergenic
1038804757 8:30780084-30780106 CAGAAAAAGAGGAAATAAATGGG + Intronic
1038814597 8:30888472-30888494 GAGAGAAAGGAGAGGGAAAAAGG - Intronic
1038886367 8:31667283-31667305 CAGAAGATGGATAAGCAAATAGG + Intronic
1038960850 8:32517954-32517976 GAGAAACAGGAGAAGAAAACAGG + Intronic
1038974028 8:32671606-32671628 AAGAAAAAGGTGGAAGAAATTGG - Intronic
1039160941 8:34618944-34618966 AAGAAAGAGGAAAAGGAAAAGGG + Intergenic
1039195656 8:35028510-35028532 GAGGAAAAGGAGCAGGGAATGGG + Intergenic
1039392457 8:37192500-37192522 TAAAAAAAGAAGAAGAAAATAGG + Intergenic
1039848578 8:41343352-41343374 GAAATAAAGGAAAAGGAAATGGG + Intergenic
1040030957 8:42823183-42823205 CAGAAATAGGAACTGGAAATAGG + Intergenic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1041067041 8:54092087-54092109 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1041140065 8:54808180-54808202 CAGAATCAGGAGCAGGAAAATGG + Intergenic
1041472547 8:58226383-58226405 CAGAAAAGGCAGAAGGAATAGGG - Intergenic
1041481481 8:58324831-58324853 CTACAAAAAGAGAAGGAAATGGG + Intergenic
1041602476 8:59736277-59736299 CAGAGAAAGGAGGATTAAATAGG + Intergenic
1041642178 8:60214989-60215011 CAGAAAAAGGAGGAAGAAAAGGG + Intronic
1041663538 8:60421524-60421546 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1041697466 8:60751304-60751326 AAGAAAAAAGTGAAAGAAATGGG - Intronic
1041738461 8:61135076-61135098 CCTAAAAAGGAGATGGAAACAGG + Intronic
1042056222 8:64767116-64767138 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1042249085 8:66738078-66738100 CAGTAAAAGGAAAATGAAATTGG - Intronic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042364602 8:67922384-67922406 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1042482428 8:69319314-69319336 TAGAAGAGGGAGAAGGAAAAGGG - Intergenic
1042531597 8:69821496-69821518 AAGAAGAAGAAGAAGAAAATAGG + Intronic
1042807107 8:72782849-72782871 CAGAAAAAGAAAAAGAAAAAAGG - Intronic
1042889348 8:73590069-73590091 AAGAAAGAGGAGAAGGAAGTAGG + Intronic
1042979116 8:74505978-74506000 CAGAAAAAGGAAACGGGAAGAGG - Intergenic
1043001306 8:74763467-74763489 CAAGAAAAGGAGAAGGAAAGGGG - Intronic
1043262170 8:78215687-78215709 AGGAAAAAGGAGACAGAAATAGG + Intergenic
1043570929 8:81601596-81601618 AAGAAAAAAGAAAAGGAAAGTGG + Intergenic
1043791327 8:84470766-84470788 CAGAAACAAGAAAAGGACATGGG - Intronic
1043849432 8:85199163-85199185 CAGAATAATGAGAGGGAAAATGG - Intronic
1043882502 8:85561344-85561366 CAGAAAAAGTAAAAAGAAACAGG - Intergenic
1044398073 8:91737105-91737127 CTGATAAAGGAGAAAGAAGTGGG + Intergenic
1044711217 8:95059863-95059885 AAGAAAAAATACAAGGAAATGGG + Intronic
1044830120 8:96239009-96239031 AAGAATAAGGAAAAGGAAAGTGG - Intergenic
1044973003 8:97638188-97638210 CAGTGGAAGGAGAAGGAACTAGG + Intergenic
1045147654 8:99365493-99365515 AAGAAGAAGAAGAAGAAAATTGG - Intronic
1045355176 8:101380633-101380655 AAGAAAAAGGAGAAGTAAAAGGG - Intergenic
1045399712 8:101801046-101801068 AGGAAAAAGGAAAAGGAAAAGGG + Intronic
1045451753 8:102333878-102333900 CATAAAAAGGAAAAGAAACTCGG - Intronic
1045613657 8:103879109-103879131 AAAGAAAGGGAGAAGGAAATTGG + Intronic
1045698086 8:104833986-104834008 CAGCAGAAGGAGAAGGAACATGG - Intronic
1045743448 8:105388317-105388339 GAGAAAAGGGAAAAGGAGATGGG + Intronic
1045776850 8:105814863-105814885 CAGAAAAAGGTCGATGAAATTGG - Intergenic
1045990081 8:108296699-108296721 CTGATCAAGCAGAAGGAAATGGG - Intronic
1046020096 8:108654631-108654653 CTGAAAGAGGAAAAGGCAATGGG + Intronic
1046055406 8:109072436-109072458 AAGGAAAAGGAAAAGGTAATTGG + Intergenic
1046123370 8:109873097-109873119 CAGATAAAGGAGATAGAAAAAGG - Intergenic
1046572885 8:115988821-115988843 CAGAAAAAAGAAAAAAAAATAGG + Intergenic
1046604574 8:116356720-116356742 CAGAAAAAGGAAACAGAAAATGG - Intergenic
1046706741 8:117462014-117462036 AAGGAAAAAGAGAAGGAAAGAGG + Intergenic
1046755858 8:117972193-117972215 CAGAAAAATGAAATGGAATTGGG + Intronic
1046903182 8:119544456-119544478 AAGAAATTGAAGAAGGAAATAGG - Intergenic
1046936186 8:119887497-119887519 CAGAAAGAAGAGAAGGGAAGGGG - Intronic
1047053217 8:121136568-121136590 AAGAAGAAGGAGAAATAAATTGG + Intergenic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1047347517 8:124042589-124042611 GTGAAACAGGAGAGGGAAATTGG - Intronic
1047401115 8:124548290-124548312 GAGAAAAAAGAAAAGGAAAAAGG + Intronic
1047620720 8:126603833-126603855 GAGAAAAAGGAGTAGGGAAAAGG + Intergenic
1047694935 8:127394131-127394153 CAGACAAAGGAGAGGGTATTGGG - Intergenic
1047775907 8:128070236-128070258 CAGCAACAGGAGAAGCAAACAGG - Intergenic
1047798671 8:128285620-128285642 AAGAAGAAGGAGAAGGAAAAGGG + Intergenic
1047913295 8:129554533-129554555 GTGATAGAGGAGAAGGAAATGGG - Intergenic
1047976104 8:130132421-130132443 CAGAAACAGGAGGATGGAATAGG - Intronic
1047997024 8:130346887-130346909 CATTACAAGGAAAAGGAAATGGG + Intronic
1048094838 8:131280612-131280634 TATTAAAAGGAAAAGGAAATAGG + Intergenic
1048276122 8:133067305-133067327 TAGAGAAAGGAGAAGCAGATGGG - Intronic
1048413755 8:134203567-134203589 AAAAAAAAGTGGAAGGAAATGGG - Intergenic
1048750502 8:137668176-137668198 CAGAACAAAGAGAATGAAGTAGG + Intergenic
1048766360 8:137848624-137848646 AAAAAAAAAGAGAAGGATATTGG + Intergenic
1049050321 8:140189583-140189605 GAGAAAAACTGGAAGGAAATAGG + Intronic
1049119539 8:140722271-140722293 CAAAAAAAGAAAAAAGAAATTGG - Intronic
1049328461 8:142037320-142037342 CAGAAAAAGAAGAAAGGAAGAGG + Intergenic
1049530766 8:143153736-143153758 CAGATAAAGGAGAAGCCATTTGG - Intergenic
1049532748 8:143163414-143163436 CAGCCAAAGGAGAGGAAAATCGG + Intergenic
1049618056 8:143584855-143584877 GGGAAAAAGAAGAAGGAAACAGG - Intronic
1049667544 8:143853127-143853149 GAGAGAAAGGAGAGGGAAGTGGG - Intergenic
1050082533 9:1930082-1930104 CACAAAAAGGAAAAGGGAAAGGG + Intergenic
1050222791 9:3413619-3413641 CAGAGCAAGGAGAAAGAAACAGG - Intronic
1050640863 9:7666176-7666198 CAGTGAAAGGAGCAGGGAATTGG + Intergenic
1050716120 9:8528261-8528283 CAGAGAAAGAAGAAAGAAAGAGG + Intronic
1050764191 9:9112022-9112044 CAGCAAAATGAGAAGAAAAATGG - Intronic
1050853758 9:10323302-10323324 CTGAAAAAGAGGAAGGGAATGGG - Intronic
1050913512 9:11103261-11103283 AAGCAAAAGTAGAAGGAAATGGG - Intergenic
1051039503 9:12789748-12789770 CAGAAATAGGTGAATAAAATAGG + Intronic
1051171030 9:14317505-14317527 CAGAAAAAGGAAAATGAGATAGG + Intronic
1051260168 9:15256169-15256191 AAAAAAAAGAAGAAGGAAAAAGG - Intronic
1051262279 9:15276298-15276320 AAGAAAAAGGAGGAGAGAATGGG - Intronic
1051359796 9:16271851-16271873 CAGAAATAGGAAAAGTGAATGGG - Intronic
1051448382 9:17166327-17166349 GAGACAAAGGAGTAGTAAATAGG + Intronic
1051659873 9:19416142-19416164 AAGAAAGAGGAGAAGAAAAATGG - Intronic
1051690196 9:19704366-19704388 CACACATAAGAGAAGGAAATAGG + Intronic
1051930949 9:22384851-22384873 AAGAGAAAGGAGAGGGACATAGG - Intergenic
1052032064 9:23640032-23640054 CAGAGAAGGGAGAAGCATATAGG - Intergenic
1052066961 9:24034115-24034137 CAGTAAAGGGAGTAAGAAATTGG - Intergenic
1052475746 9:28956761-28956783 CAAGAAAAGGAGAAGGGAAGGGG - Intergenic
1052560166 9:30075328-30075350 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
1052854741 9:33400277-33400299 CAGAGCAAGGAGAGGGGAATTGG + Intronic
1052962133 9:34307878-34307900 AAGAAAAAAGAAAAAGAAATTGG + Intronic
1053359142 9:37470918-37470940 AAGAAAAAGGAAAAAGAAAATGG + Intergenic
1053485010 9:38445794-38445816 CAAAAAAAGCAGAAGGATGTGGG + Intergenic
1053668128 9:40331522-40331544 CAGAGAAAGCAAAGGGAAATTGG + Intergenic
1053682761 9:40496558-40496580 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1053836457 9:42141419-42141441 CAGAAACAGGAGAAAGAAGGAGG + Intergenic
1054280953 9:63128371-63128393 CAGAGCAAGGAGAGGGGAATTGG - Intergenic
1054295861 9:63332072-63332094 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054379272 9:64471578-64471600 CAGAGAAAGCAAAGGGAAATTGG + Intergenic
1054393878 9:64636567-64636589 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054428527 9:65141780-65141802 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054501852 9:65879765-65879787 CAGAGCAAGGAGAGGGGAATTGG - Intronic
1054516483 9:66044771-66044793 CAGAGAAAGCAAAGGGAAATTGG - Intergenic
1055122969 9:72684501-72684523 CAGAAAAAGGAGACTCAAAATGG - Intronic
1055151893 9:73010401-73010423 CAGAAATAAGAGAAGGAACATGG - Intronic
1055339844 9:75269580-75269602 CACAAAAAGGAGAAGTGACTGGG - Intergenic
1055752127 9:79518351-79518373 AAGGAAAAGAAGAAGGAAGTTGG - Intergenic
1056008458 9:82300355-82300377 CACAAAAAGGAGAAAGAGAAAGG - Intergenic
1056141644 9:83686573-83686595 CATAAAAAGAATAAGGATATTGG - Intronic
1056385358 9:86092362-86092384 CAGAGTCAGGAGAAGGAAAGAGG - Intronic
1056704594 9:88941239-88941261 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1056850472 9:90079720-90079742 AAGAGAAAGATGAAGGAAATTGG + Intergenic
1057079868 9:92165361-92165383 TAGAGAAAGGGGAAGGAGATAGG + Intergenic
1057276418 9:93678122-93678144 CAGAAAGAGGAGGAGCAAGTGGG + Exonic
1057314737 9:93960974-93960996 AAGAAAGAGGAGGGGGAAATGGG - Intergenic
1057367381 9:94435636-94435658 AAAAAAAAGAAGAAGGAAAAAGG - Intronic
1057610073 9:96534516-96534538 CAGAAAATGGAGATTTAAATTGG - Exonic
1057632159 9:96728370-96728392 AAGAACAAGAAAAAGGAAATGGG - Intergenic
1058170634 9:101676855-101676877 CAGAAAAAAAAAAAGGAAAAGGG - Intronic
1058251825 9:102707536-102707558 TAAAAAAAGGAGATTGAAATAGG - Intergenic
1058387415 9:104454105-104454127 GAGAAAAAGAACAAGGAACTGGG + Intergenic
1058409458 9:104715263-104715285 AAGAAGAAGGAGAAGGAAAAGGG - Intergenic
1058561456 9:106233246-106233268 AGGAAAAAGGAGGAGGAAAAAGG - Intergenic
1058561469 9:106233307-106233329 AAGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058923987 9:109643730-109643752 CAGAAAACAGAGTTGGAAATTGG - Intronic
1058951970 9:109912313-109912335 AAAAAAAAAGAGGAGGAAATGGG + Intronic
1059000215 9:110340896-110340918 AAGAAAAAGGAGAATGGAAATGG - Intergenic
1059150778 9:111947934-111947956 CAGAAAAAGGGGGAGGAGCTTGG - Intergenic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059506498 9:114804059-114804081 GAAGAAAAGGAGAGGGAAATGGG - Intronic
1060106400 9:120876199-120876221 GAGAAAAAGGAGATGGGAGTGGG - Intronic
1060271788 9:122148328-122148350 CAGAAAAGTGAGAAAAAAATAGG + Intronic
1060399810 9:123341836-123341858 GAGAAAAAGGAGGAGAAACTGGG - Intergenic
1060634190 9:125187274-125187296 AAAAAAAAAGAAAAGGAAATTGG - Intronic
1060860023 9:126946571-126946593 CAGAGTTAGGAAAAGGAAATGGG + Intronic
1061474359 9:130854014-130854036 AAGAAAAAGGAAGAGAAAATTGG - Intronic
1061835567 9:133326965-133326987 AAGAAAAAAGAAAAGAAAATTGG + Intergenic
1062727943 9:138087860-138087882 CAGTAAAAGCAGTATGAAATGGG + Intronic
1185707372 X:2277580-2277602 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707391 X:2277669-2277691 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707410 X:2277758-2277780 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707430 X:2277847-2277869 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707449 X:2277936-2277958 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707488 X:2278112-2278134 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707508 X:2278201-2278223 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707547 X:2278377-2278399 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707567 X:2278466-2278488 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707587 X:2278555-2278577 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707607 X:2278644-2278666 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707645 X:2278824-2278846 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707664 X:2278913-2278935 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707683 X:2279002-2279024 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707703 X:2279091-2279113 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707722 X:2279180-2279202 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707741 X:2279269-2279291 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707874 X:2279876-2279898 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707894 X:2279965-2279987 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707914 X:2280054-2280076 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707934 X:2280143-2280165 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707972 X:2280323-2280345 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185707991 X:2280412-2280434 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708010 X:2280501-2280523 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708030 X:2280590-2280612 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708049 X:2280679-2280701 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708068 X:2280768-2280790 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708238 X:2281549-2281571 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708258 X:2281638-2281660 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708278 X:2281727-2281749 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708337 X:2281997-2282019 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185708357 X:2282086-2282108 GAGAAGGAGGAGGAGGAAATGGG + Intronic
1185741386 X:2535623-2535645 AAGAAAAAGGAAAAAGAAATAGG - Intergenic
1185787482 X:2903110-2903132 GAGAAAAAGAAGAAGGAGAAGGG - Intergenic
1186034452 X:5405926-5405948 CAGAAAGAGAAAAAAGAAATAGG - Intergenic
1186519638 X:10194012-10194034 AAGATACAGGAGAAGGAAAGGGG + Intronic
1186620934 X:11239445-11239467 CAGATCAAGGAGATGCAAATAGG - Intronic
1186661438 X:11671476-11671498 GAGAGAAAGGAGAAGGCAAATGG + Intergenic
1186676689 X:11824652-11824674 CAGAAAGAGGAGGAGAAAATGGG + Intergenic
1186683003 X:11895587-11895609 CAGTTAAATGAGATGGAAATGGG + Intergenic
1186839585 X:13471621-13471643 GAGAAAAAAGAGAGGGAAACAGG + Intergenic
1187317497 X:18209786-18209808 CAGAAAAAGGACATGGGATTGGG + Intronic
1187377907 X:18773592-18773614 CAGCAAAAAGAAAAGGAAAAGGG - Intronic
1187413716 X:19074030-19074052 CAGAAAAAGAATCAGGAAACTGG + Intronic
1187628909 X:21146317-21146339 AAAAAAAAGGAAAAGGAAATAGG - Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1188281903 X:28280844-28280866 CAGAAAAAGGAGAAATAAATAGG - Intergenic
1189067384 X:37824807-37824829 AAGAAATAGGAGAGGGAGATTGG - Intronic
1189097235 X:38153538-38153560 CAGAAAGAAGAAAATGAAATGGG - Intronic
1189348018 X:40257156-40257178 AAAAAAAAGGAAAAGAAAATGGG - Intergenic
1189481340 X:41394451-41394473 CAGAAGAAGGAGGAGGGATTAGG + Intergenic
1189617863 X:42802523-42802545 CAAAAAAAGAACAAGGAAAATGG - Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189723821 X:43948639-43948661 AAAAAAAAGGAGACAGAAATGGG - Intergenic
1190250211 X:48717754-48717776 AAGAAAAAGAAAAAAGAAATTGG - Intergenic
1190400949 X:50034416-50034438 CAGAAAAGGGAGAATGCAAGAGG - Intronic
1190799517 X:53774659-53774681 CTGAGAAAGTAGAAGGGAATGGG + Intergenic
1190866284 X:54387424-54387446 AAAAAAAACGAGAAGGAAAGAGG - Intergenic
1190875544 X:54457755-54457777 CAGAAAAAGATGAAAGAAGTAGG - Intronic
1191104593 X:56764650-56764672 CAGAAAGAGGGAAAGAAAATGGG - Intergenic
1191176673 X:57510253-57510275 CAGGAAAAGAAAAAGGAAAGAGG + Intergenic
1191641924 X:63435133-63435155 CACAAGAAGGAGAGGGAAATGGG + Intergenic
1191678366 X:63815426-63815448 CAGAGGAAGGTGAAGGAAAATGG - Intergenic
1191838991 X:65496473-65496495 CAGAAAAAGAAGAGAGAAAATGG + Intronic
1192106808 X:68325781-68325803 CGGGAAAAGGAGAAGGATACCGG - Intronic
1192336389 X:70223867-70223889 TAGAGAAAGGAGTAGGAAGTGGG - Intergenic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1193023473 X:76818327-76818349 CAGAAAAACAAAAAGGATATTGG + Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193538528 X:82742207-82742229 CATAAAATGCAGAAAGAAATTGG + Intergenic
1193667507 X:84340080-84340102 CAGGGAAAGGGAAAGGAAATGGG + Intronic
1194101399 X:89709979-89710001 CATAAAAAGAAAAAGGACATTGG + Intergenic
1194127547 X:90038969-90038991 AAGAAAAATAAGAAGGAAAATGG + Intergenic
1194537632 X:95125622-95125644 GAGAAGGAGGAGAAGGAAAGAGG + Intergenic
1194566886 X:95500040-95500062 GAGAAAAAGGAGTTGAAAATAGG - Intergenic
1194620873 X:96169813-96169835 CAGAGAGAGCAGAAAGAAATGGG + Intergenic
1194701290 X:97118287-97118309 TAGGGAAAGGAGAAGGAAAATGG - Intronic
1194706702 X:97183827-97183849 CAAAAAAATGAGAAAGAAAATGG + Intronic
1194853977 X:98905535-98905557 CTGAAAAATGAGAAGACAATTGG - Intergenic
1195037577 X:100984089-100984111 CAAAAAAAAAAGAAGGAAAATGG - Intronic
1195073700 X:101305677-101305699 AAGAAAAAAGAAAAAGAAATGGG + Intergenic
1195158479 X:102146910-102146932 AAGAAAAAGGAGAATTAAAATGG - Intergenic
1195274143 X:103263507-103263529 CAGAAAAAGAAGGACAAAATTGG - Intergenic
1195425394 X:104723644-104723666 CAGAGAAATGACAAGGAATTTGG + Intronic
1195431938 X:104798715-104798737 CAGTGAAAGAAGATGGAAATGGG - Intronic
1195661466 X:107383364-107383386 TAGATAAAGGGGAAAGAAATGGG + Intergenic
1195745317 X:108111637-108111659 CAGAAAAGGGAGATGAACATGGG - Intronic
1195973966 X:110505161-110505183 AAGGAAAAGGAGAAGGAGAAGGG - Intergenic
1196049771 X:111292651-111292673 CAAAGAAAGTAGATGGAAATGGG - Intergenic
1196483347 X:116177206-116177228 AACAAAAAAGAGAAAGAAATAGG - Intergenic
1196484084 X:116183893-116183915 CACAGAAAGGAGAAGGAGAAAGG + Intergenic
1196673390 X:118393216-118393238 AAGAAAAAGGAAAAGCGAATTGG + Exonic
1196712677 X:118779510-118779532 TAGAACGAGGGGAAGGAAATGGG + Intronic
1196770581 X:119289578-119289600 GAGAAAGAGGAGAGAGAAATTGG + Intergenic
1197164004 X:123356319-123356341 AAGGAAGAGGAGAAGGAAAGGGG - Intronic
1197200514 X:123744729-123744751 AAGAAAAAAGAAAAGGAAAAGGG + Intergenic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1197440522 X:126482960-126482982 GAGAAAAATGAGAAAGAAACAGG + Intergenic
1197673268 X:129302240-129302262 CAGAAAAAGGACAAGGACAAAGG - Intergenic
1197767869 X:130070813-130070835 AAGAAAAAGGAAAAGAAAAAAGG + Intronic
1197954478 X:131931258-131931280 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1198075098 X:133186339-133186361 CAGGGAAAGGAGCAGGAAAGAGG + Intergenic
1198123117 X:133614159-133614181 CAGAAGCAGGAGAGAGAAATAGG + Intronic
1198426522 X:136526278-136526300 TAGAAATAGGAGAAGCATATTGG - Intergenic
1198516927 X:137418069-137418091 AGGAAAAAGGAGAAAGAAAGAGG + Intergenic
1198678153 X:139152982-139153004 CAGAAAAATAAGTAGGCAATTGG + Intronic
1198988119 X:142479154-142479176 GAGAAAAAAGAAAAAGAAATGGG + Intergenic
1199328588 X:146531453-146531475 AAGAAAAAGGAGAATGAATAAGG + Intergenic
1199374256 X:147088445-147088467 AAGCAAAAGGAAAAGTAAATGGG - Intergenic
1199511376 X:148626739-148626761 GAGAGAAAGGAGAGGGAGATTGG - Intronic
1199616141 X:149657707-149657729 CAGAGAGAGGAGCAGGGAATTGG - Intergenic
1199626499 X:149745541-149745563 CAGAGAGAGGAGCAGGGAATTGG + Intergenic
1200324383 X:155222484-155222506 GAAAAAAAGGAAAAGAAAATGGG + Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200397479 X:155999628-155999650 CAGAAAATGGTGCTGGAAATGGG - Intronic
1200454351 Y:3371063-3371085 CATAAAAAGAAAAAGGACATTGG + Intergenic
1200834979 Y:7724425-7724447 CAGAAAAAGGGGAAGGCCAAAGG + Intergenic
1201265378 Y:12201363-12201385 GAGCAAAAGAAGAAGGGAATAGG - Intergenic
1201417398 Y:13761123-13761145 CAAAACATGGAAAAGGAAATGGG - Intergenic
1201724004 Y:17134344-17134366 TAGAATTAGGAGAAGGAAAATGG - Intergenic
1202064711 Y:20926102-20926124 CAGGAAAAGGAGATAGGAATAGG - Intergenic
1202101134 Y:21309230-21309252 GGGAAAAAGGAGAAGAAAAAAGG + Intergenic
1202196106 Y:22299440-22299462 AAGAAAAAAGAAAAAGAAATAGG + Intergenic