ID: 1138287535

View in Genome Browser
Species Human (GRCh38)
Location 16:55821576-55821598
Sequence TCAGGACCACAGATGGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138287535 Original CRISPR TCAGGACCACAGATGGGGCT AGG Intronic
900650280 1:3727024-3727046 CCAGGACCAGACATGGAGCTGGG + Intronic
900888576 1:5432626-5432648 TCAGGACAGCAGCTGGGGCTCGG + Intergenic
901353313 1:8618738-8618760 TTAGGACCATAGATGATGCTGGG - Intronic
902170307 1:14604798-14604820 ACAGGAGCTCAGATGGAGCTTGG + Intronic
902343776 1:15801046-15801068 TCAGGACCGCAGGAGGGGGTGGG + Intergenic
902490118 1:16775387-16775409 TCAGGTGCACAGAAGGAGCTGGG + Intronic
902974758 1:20080758-20080780 TCAGGCCCACAGAAGAGGCCGGG - Intronic
903534808 1:24059927-24059949 GCAGGACCCCAGATGGGGAGGGG + Intronic
904000547 1:27336182-27336204 TGAGGTCCACACCTGGGGCTGGG - Exonic
905231220 1:36515945-36515967 TCAGGTCACCAGATGGTGCTGGG + Intergenic
905303133 1:36999086-36999108 TCAGGGGAACAGATGGGGCATGG + Intronic
906157573 1:43622774-43622796 CCAGAACCACAGATGTGTCTGGG + Exonic
906199913 1:43953328-43953350 TTATGACCACAGCTGAGGCTGGG - Intronic
907430618 1:54409146-54409168 TCAGGCCCAAAGATGTGGCCTGG - Intronic
909305611 1:74072421-74072443 TAAGGACCATAGATGGGCTTTGG + Intronic
912491710 1:110066100-110066122 TCAGGATCACAGCTGTGGTTGGG + Intronic
913957968 1:143320841-143320863 GCAGGACCAGCAATGGGGCTGGG + Intergenic
914052277 1:144146199-144146221 GCAGGACCAGCAATGGGGCTGGG + Intergenic
914126920 1:144820342-144820364 GCAGGACCAGCAATGGGGCTGGG - Intergenic
915294244 1:154909007-154909029 GCAGGGCCATAGATGGGGGTGGG + Intergenic
915315426 1:155026124-155026146 TCTGGACCCAAGATGGGGCTGGG - Intronic
915684063 1:157613464-157613486 TCAGTAACACAGATAGAGCTGGG + Intergenic
915885085 1:159713525-159713547 TCAGGGCCACAGCTGGGGTTTGG + Exonic
916451590 1:164926294-164926316 TCAGATGCACAGATGGGGGTAGG + Intergenic
917035674 1:170744784-170744806 TCAGGCCCTGAGAGGGGGCTTGG - Intergenic
919530718 1:198716007-198716029 TCAGGACAACAGCTCTGGCTGGG - Intronic
921124236 1:212162692-212162714 TAAAGACCAGAGATGGGGGTTGG - Intergenic
921622763 1:217344198-217344220 TCTGGGCCAGAGATGGGGGTGGG + Intergenic
923340851 1:233005828-233005850 TCAGGCCAACAGCTGGAGCTGGG + Intronic
923530319 1:234807143-234807165 TCAGGTGCACAGAAGGAGCTGGG - Intergenic
1064699332 10:18002377-18002399 TCAGGACCACAGATAGGGGATGG - Intronic
1064771807 10:18730897-18730919 TCAGGACTACAGAAGTGGCCTGG - Intergenic
1065835759 10:29656657-29656679 ACAGGAACTCAGAAGGGGCTTGG - Intronic
1066167934 10:32808276-32808298 TCAGGGCAACTGATGGGGCAAGG - Intronic
1066482595 10:35811667-35811689 TCAGGACCAGGGATGGTGCTAGG - Intergenic
1067078977 10:43203165-43203187 TCAGGGCTAGAGTTGGGGCTTGG - Intronic
1067540029 10:47144367-47144389 TAAGGAACCCACATGGGGCTAGG + Intergenic
1068632721 10:59314289-59314311 TCTGGCCCACAGCAGGGGCTCGG - Intronic
1068898252 10:62232446-62232468 TTGGGACTACAGCTGGGGCTGGG + Intronic
1069101822 10:64331690-64331712 TGAGGAACACAGATTGGCCTGGG + Intergenic
1070636336 10:78131154-78131176 ACAGAAGCACAGATGTGGCTTGG - Intergenic
1070806264 10:79272889-79272911 TGGTGACCACAGCTGGGGCTGGG - Intronic
1071054931 10:81498671-81498693 TCAAGCCCAAAGATGGGGCAGGG - Intergenic
1071303092 10:84272518-84272540 ACAGGTGAACAGATGGGGCTGGG - Intergenic
1072618897 10:97067154-97067176 TCAGGAGCACGCAAGGGGCTGGG + Intronic
1073096698 10:100984332-100984354 TGAGGAGCACCGATGGGCCTGGG - Exonic
1073575327 10:104618289-104618311 TCAGGAACACTGATGGGGTTGGG - Intergenic
1073754837 10:106570665-106570687 TTAGGAAAAAAGATGGGGCTGGG - Intergenic
1073814467 10:107191188-107191210 TTAGGATCACAGATGTTGCTTGG + Intergenic
1074028627 10:109663145-109663167 CCAGGTCCACAGCTGTGGCTTGG - Intergenic
1075408407 10:122210084-122210106 TCAGGACCAGACATGGTTCTAGG - Intronic
1075587426 10:123667801-123667823 TCAGGAGGGCAGATGGAGCTGGG + Intronic
1075758119 10:124832547-124832569 TCAGAAATACAGATAGGGCTGGG + Intronic
1076411585 10:130255246-130255268 TCAGGACTCCAGATGGAGATCGG + Intergenic
1076735249 10:132456052-132456074 TATGGAGCACAGGTGGGGCTGGG + Intergenic
1076854003 10:133106402-133106424 GCAGGACCACAGCTTGGGCCTGG - Intronic
1077145568 11:1042768-1042790 TGAGGACCAGAGCTGGGGGTGGG + Intergenic
1077219727 11:1410646-1410668 TCAGGGCCACAGGTGTGCCTGGG - Intronic
1077319943 11:1936638-1936660 TACGGAGCACGGATGGGGCTGGG - Intronic
1077339739 11:2020970-2020992 GCGGGGCCACAGGTGGGGCTGGG + Intergenic
1077342683 11:2033040-2033062 TCAGGCCCACAGCTTGGGCAGGG + Intergenic
1081775046 11:45670937-45670959 GCTGGATCACAGATGTGGCTCGG - Intergenic
1083275244 11:61593399-61593421 TCAGGACCAAAGTCTGGGCTTGG + Intergenic
1083736567 11:64685029-64685051 GCAGGAGCAGAGAGGGGGCTTGG - Intronic
1084562445 11:69912380-69912402 TCAGGGCCAGTGCTGGGGCTGGG - Intergenic
1087271984 11:96121191-96121213 CCAGGGCCAAAGATGGGGTTTGG - Intronic
1088470439 11:110183740-110183762 TCAGGCCCACTGAAGGGGCCAGG + Intronic
1091294124 11:134460599-134460621 TGAGGCCCACAGATGAGCCTGGG - Intergenic
1202822724 11_KI270721v1_random:76159-76181 GCGGGGCCACAGGTGGGGCTGGG + Intergenic
1202825669 11_KI270721v1_random:88229-88251 TCAGGCCCACAGCTTGGGCAGGG + Intergenic
1091721901 12:2820074-2820096 TCATGCCCACAGATGGAGATGGG + Exonic
1091985463 12:4907715-4907737 TCTGGCCCATAGCTGGGGCTGGG + Intergenic
1093445470 12:19251878-19251900 TCAGGACCACAGGAAGGGCAGGG - Intronic
1094361930 12:29640051-29640073 TCAGGACTACTGATGGGTCTCGG - Intronic
1094417686 12:30234869-30234891 TCAGGACCAGTGGTGGGGCAGGG + Intergenic
1096718269 12:53503782-53503804 TTAGGACTACAGATGGAACTGGG - Exonic
1096772820 12:53947004-53947026 TCAGGACTGGAGTTGGGGCTGGG + Intergenic
1096870111 12:54587843-54587865 TGAGGACCACTGAGAGGGCTGGG - Intronic
1097382916 12:58917132-58917154 TCCGGACCACAGTTGGGGGTGGG - Intronic
1100847751 12:98678457-98678479 CCAGGTCCACAGCTGTGGCTTGG - Intronic
1101346265 12:103889108-103889130 TCAGGGACACAGAAGGAGCTGGG + Intergenic
1103443691 12:120980581-120980603 CCAGGGCCCCAGATGGGACTGGG + Intronic
1103735217 12:123056763-123056785 ACAGGACCCCTGATTGGGCTGGG - Intronic
1104960403 12:132486008-132486030 GCCGGCTCACAGATGGGGCTGGG + Intergenic
1105284194 13:18991492-18991514 TCAAGACCAGAGCTGGGGTTAGG - Intergenic
1105437446 13:20390809-20390831 CCAGGACCACAACTGGGCCTCGG - Intergenic
1108263703 13:48683023-48683045 GCAGGAACACGGATGGAGCTGGG - Intronic
1108551797 13:51553569-51553591 TCAGGAGCAGAAATGGGGGTGGG + Intergenic
1113313695 13:109157058-109157080 TGGGGACCACAGCTGGGGCGTGG - Intronic
1114219731 14:20685371-20685393 TCAGCACCACTCAGGGGGCTAGG + Intronic
1115911068 14:38256293-38256315 TCAGGAACACAGCTGGCGCCGGG + Exonic
1119263697 14:73252402-73252424 TCAGGACCGGAGCTGGGCCTGGG + Intronic
1120324277 14:83005659-83005681 TCAGGACCACATATGGCCTTTGG - Intergenic
1120331776 14:83102541-83102563 TCAGGGACACAGATGGAGCTGGG + Intergenic
1121315418 14:92958458-92958480 ACAGGACCAGGGATGGGCCTTGG - Intronic
1122110039 14:99493105-99493127 TTAGGATCACAGTTGAGGCTGGG + Intronic
1122330281 14:100907354-100907376 CCAGCACCACAGCTGGGACTTGG - Intergenic
1122812512 14:104296097-104296119 TCCAGACCCCAGATGGGCCTGGG + Intergenic
1122841500 14:104466385-104466407 TAAGGAACACAGATGGATCTTGG - Intergenic
1122859690 14:104577051-104577073 TCACTACCACAGAGGGAGCTGGG + Intronic
1123221908 14:106865427-106865449 TCAGGACACCAGAGGGTGCTCGG - Intergenic
1123421935 15:20142177-20142199 GCAGGACCAGCAATGGGGCTGGG + Intergenic
1123531163 15:21148717-21148739 GCAGGACCAGCAATGGGGCTGGG + Intergenic
1124447495 15:29750432-29750454 TAAGAACCACGGATAGGGCTGGG - Intronic
1128144523 15:65325399-65325421 TCAGGACCAGTGACGGTGCTAGG - Intergenic
1129035867 15:72648102-72648124 GCAGGACAGCAGAGGGGGCTAGG - Intergenic
1129214018 15:74089114-74089136 GCAGGACAGCAGAGGGGGCTAGG + Intergenic
1129356990 15:74997869-74997891 TCAGGGCAGAAGATGGGGCTAGG + Intronic
1129391406 15:75222816-75222838 GCAGGACAGCAGAGGGGGCTGGG - Intergenic
1129399994 15:75276249-75276271 GCAGGACAGCAGAGGGGGCTAGG - Intronic
1129472900 15:75765040-75765062 GCAGGACAGCAGAGGGGGCTGGG + Intergenic
1129731154 15:77933459-77933481 GCAGGACAGCAGAGGGGGCTGGG + Intergenic
1130196169 15:81782223-81782245 CCAAGACAACAGATGGGACTGGG + Intergenic
1130602569 15:85286608-85286630 TCAGTGATACAGATGGGGCTGGG + Intergenic
1130694385 15:86115794-86115816 TCAGGACCAGAGATATAGCTGGG - Intergenic
1130906236 15:88242638-88242660 TCTGGCCCACAGCTGGTGCTAGG + Intronic
1131072282 15:89473374-89473396 CCAGGACCACAGATGGGGCAAGG - Intronic
1131082754 15:89550647-89550669 GCAGGGACACAGATGGAGCTAGG + Intergenic
1131278469 15:91002005-91002027 TCAGGACAACAGCTGGAGCAGGG + Intronic
1132286036 15:100663261-100663283 TCAGGGCAACAGATGGAGCCAGG + Intergenic
1132360337 15:101207827-101207849 TCAGGACAACGGGTGGGGCAGGG - Intronic
1132905024 16:2278081-2278103 GCGGGACCTCAGATAGGGCTTGG + Intronic
1133284753 16:4685431-4685453 TCAGGCCCACAGACGGGGGCAGG + Intronic
1133286032 16:4691274-4691296 TCAGGACTAGAGATGGGGACCGG - Intergenic
1133317405 16:4893179-4893201 TCAGGAGCACAGGTGGGGCCGGG - Intronic
1135461746 16:22649989-22650011 GCAGGCACACAGATGGAGCTGGG - Intergenic
1136489963 16:30601138-30601160 TCAGCAACACAGCTGGGCCTGGG - Intergenic
1136723095 16:32339501-32339523 GCAGGACCAGCAATGGGGCTAGG + Intergenic
1136773865 16:32860922-32860944 GCAGGACCAGCAATGGGGCTAGG - Intergenic
1136841417 16:33545500-33545522 GCAGGACCAGCAATGGGGCTAGG + Intergenic
1136896746 16:34000597-34000619 GCAGGACCAGCAATGGGGCTAGG + Intergenic
1138118349 16:54378240-54378262 TAAGGACCACAGATGAGGAGAGG - Intergenic
1138280997 16:55772291-55772313 TCAGGACTACAGATGCGGCTGGG - Intergenic
1138287535 16:55821576-55821598 TCAGGACCACAGATGGGGCTAGG + Intronic
1141165783 16:81660096-81660118 GCCGGACCACAGCTGGGGTTTGG - Intronic
1141756728 16:85996302-85996324 TAAGGACCACAGCTGCCGCTTGG + Intergenic
1142244349 16:88962688-88962710 TGAGGACCACAGGAGGTGCTGGG - Intronic
1142276670 16:89122377-89122399 TCAGGACAACAGCATGGGCTGGG - Intronic
1142365269 16:89646733-89646755 TCTGGACAACAGGTGGGGCCAGG + Intronic
1203003336 16_KI270728v1_random:178263-178285 GCAGGACCAGCAATGGGGCTAGG - Intergenic
1203076285 16_KI270728v1_random:1123033-1123055 GCAGGACCAGCAATGGGGCTAGG - Intergenic
1203134944 16_KI270728v1_random:1714670-1714692 GCAGGACCAGCAATGGGGCTAGG - Intergenic
1203151582 16_KI270728v1_random:1845797-1845819 GCAGGACCAGCAATGGGGCTAGG + Intergenic
1142678506 17:1531100-1531122 TCAGGACCCCAGGTGCTGCTAGG + Intronic
1143032761 17:3976915-3976937 CCAGGTCCTCAGATGGGGCCCGG + Intergenic
1144521739 17:15957270-15957292 TGAGAACCACAGATGGGCCCTGG + Intronic
1144659952 17:17061567-17061589 TCTGGACCAAAGGTGGGGGTGGG - Intronic
1147120734 17:38333814-38333836 TGAGGACGACAGAAGGTGCTGGG - Intronic
1147424474 17:40339435-40339457 TCTGGCCCGCAGCTGGGGCTGGG - Intronic
1148159753 17:45443266-45443288 TCTGGGCCACAGATGGCCCTGGG - Intronic
1149735133 17:58986803-58986825 TTAAGATGACAGATGGGGCTGGG - Intronic
1150267294 17:63839747-63839769 TCAGGGCCACATTTGGGGCAGGG - Intronic
1150338018 17:64344119-64344141 CCAGGCCCACAGTGGGGGCTGGG + Intronic
1150391039 17:64790138-64790160 TCTGGGCCACAGATGGCCCTGGG - Intergenic
1151576473 17:74954805-74954827 GCAGGACCAGAGATGGGGACTGG - Intronic
1151764275 17:76124202-76124224 TCAGGACCAGACTTGGAGCTGGG + Intergenic
1152596048 17:81238387-81238409 GCTGGACCTCAGAGGGGGCTGGG - Intronic
1153982457 18:10321854-10321876 TCAGGACCAGAAAGGGGGCCTGG - Intergenic
1155041077 18:22066094-22066116 TCAGGGCCACAGCTGGGGGTAGG - Intergenic
1157097153 18:44696362-44696384 TCAGAACCACTGAGAGGGCTTGG + Intronic
1158447942 18:57537348-57537370 TAAAGAGCACAGCTGGGGCTGGG - Intergenic
1158635060 18:59148908-59148930 TTAAGAGCACAGGTGGGGCTGGG - Intronic
1158809942 18:61020786-61020808 TCCGGACACCAGCTGGGGCTGGG - Intergenic
1159479462 18:68969184-68969206 TCAGGAACCTGGATGGGGCTGGG - Intronic
1160099206 18:75904583-75904605 TCAGGGCCGCAGGTGAGGCTGGG + Intergenic
1160499992 18:79396671-79396693 TCAGGACCACAGAGGGCACGTGG + Intronic
1161608111 19:5225864-5225886 TCAGCACGACGGCTGGGGCTGGG + Intronic
1162015451 19:7844444-7844466 TCAGAACCACAGATGGAGTTGGG - Intronic
1163818190 19:19480736-19480758 CGAGGACCACTGAGGGGGCTGGG - Intronic
1164900241 19:31913620-31913642 TCAGCTCCATAGGTGGGGCTTGG - Intergenic
1165469948 19:35997419-35997441 TCAGGATCTCAGCTGGGGCCCGG + Intergenic
1166196256 19:41207660-41207682 TCAGGACCAGATGTGGAGCTGGG + Intergenic
1166224379 19:41386039-41386061 GCAGGAGAGCAGATGGGGCTGGG - Intronic
1168400101 19:56080708-56080730 TCATGACCACAGATGGGACATGG + Intergenic
1168600974 19:57718427-57718449 TCAAGACCACTGCTGGGGCTGGG - Intronic
1202691674 1_KI270712v1_random:98623-98645 GCAGGACCAGCAATGGGGCTGGG + Intergenic
925269268 2:2590752-2590774 TCAAGACTACAGTAGGGGCTTGG + Intergenic
926214822 2:10898487-10898509 TCAGGAACAGATATGGAGCTGGG + Intergenic
928891898 2:36214029-36214051 TCAGGAATACAGCTGGGACTGGG + Intergenic
929587253 2:43124356-43124378 TGAGGACCACAGATGTGGGGTGG - Intergenic
930231166 2:48845197-48845219 TCTGGACCACACACAGGGCTAGG - Intergenic
930509506 2:52326815-52326837 TCAGGACATCACATGGGCCTGGG - Intergenic
931231726 2:60380821-60380843 ACAGCCCCACAGATGGAGCTGGG - Intergenic
931688089 2:64811878-64811900 TCAGGACCTCAGCTGGAGGTAGG - Intergenic
931703012 2:64924194-64924216 TCAGACCCACAGATGGGGATGGG + Intergenic
932087099 2:68772235-68772257 TTAGGACCACAGTGGGGGTTAGG - Intronic
932206324 2:69886488-69886510 TCAGCACCACAGAGGTGTCTGGG - Intergenic
932453947 2:71834391-71834413 TCAGAAGCCCAGATGTGGCTGGG - Intergenic
932833784 2:75015478-75015500 TCAGGAACACACATGGGGAAAGG + Intergenic
933543038 2:83672527-83672549 TCAAGACCTCATATGGGGCCAGG - Intergenic
933833434 2:86228116-86228138 TCAGCACCCAGGATGGGGCTGGG - Intronic
933954714 2:87355327-87355349 GCAGGACCAGCAATGGGGCTGGG - Intergenic
934238911 2:90251553-90251575 GCAGGACCAGCAATGGGGCTGGG - Intergenic
934274284 2:91565157-91565179 GCAGGACCAGCAATGGGGCTGGG + Intergenic
934984164 2:98872016-98872038 CCAGCAACACAGATGGAGCTGGG + Intronic
937229674 2:120390351-120390373 TCAGGAGCACAGAGGGGTCTGGG + Intergenic
938570147 2:132555335-132555357 TCAGGAATGCAGAAGGGGCTTGG + Intronic
938998205 2:136703106-136703128 TCAGGACCAATGATGGGGACTGG + Intergenic
940628683 2:156209735-156209757 TCAGGAACATGGATGGTGCTGGG - Intergenic
943876411 2:193072766-193072788 CCAGGCCCACAGGTGGTGCTTGG + Intergenic
945038089 2:205721474-205721496 GCAGCACCACAGATGGGTCCCGG - Intronic
948063392 2:235058670-235058692 TCTGGACCACTGATGGGGAAAGG - Intergenic
948069341 2:235107020-235107042 GCAGCCCCACAGATGGGGGTCGG - Intergenic
948372331 2:237497272-237497294 ACTGGGCCACAGCTGGGGCTTGG + Intronic
948973012 2:241443743-241443765 TCAAGTCCACAGATAGGGTTGGG + Intronic
948983016 2:241504478-241504500 TCAGCAGCAGTGATGGGGCTGGG - Intronic
1170715725 20:18829235-18829257 TCAAGACTACAAAGGGGGCTAGG - Intronic
1170763136 20:19269335-19269357 TCAGGAGCTCAGAAGGGGATAGG + Intronic
1171094918 20:22323115-22323137 TCAGGACCAGATGTGGGTCTTGG - Intergenic
1172017480 20:31886473-31886495 TGAGGATCCCAGAAGGGGCTAGG - Intronic
1172647303 20:36478902-36478924 TTAGGACCTCAGATGGTGATTGG + Intronic
1172846611 20:37933402-37933424 TCACGACAGCAGATGAGGCTCGG - Intronic
1173251230 20:41365222-41365244 TGAGGCCCACAGATGGAGGTGGG - Intronic
1173710193 20:45148818-45148840 TCAGGAGCAGACTTGGGGCTGGG - Intergenic
1173714472 20:45190264-45190286 TCAGGGGCAGAGCTGGGGCTGGG + Intergenic
1174146357 20:48455267-48455289 CCAGGACCAGAGCTGGGGCCTGG + Intergenic
1175189951 20:57204724-57204746 CCAGGACCACAGATGGGCGCAGG + Intronic
1178985475 21:37299135-37299157 TCAGGACCTCAGCTGGGCCTCGG - Intergenic
1180549789 22:16530004-16530026 GCAGGACCAGCAATGGGGCTAGG - Intergenic
1180954762 22:19736727-19736749 TCAGGGCCACAGCTGGGGCCTGG + Intergenic
1181442248 22:22942570-22942592 TCAGGACCACTCTTGGGGCAGGG + Intergenic
1182103714 22:27674347-27674369 TCAGGACCTTACCTGGGGCTGGG - Intergenic
1183962178 22:41418165-41418187 TCAGCGCCACAGTTGGGGATGGG - Intergenic
1184033467 22:41907907-41907929 ACAGGACCACAGACTGGGATGGG + Intergenic
950193753 3:10994719-10994741 CCAGGAACTTAGATGGGGCTGGG + Intronic
950647122 3:14383771-14383793 TCAGGGCCACAGCTGGGCCAGGG - Intergenic
954454771 3:50591803-50591825 AGAGGGCCAAAGATGGGGCTGGG + Intergenic
954534149 3:51345486-51345508 CTAGGACTACAGGTGGGGCTAGG - Intronic
954698417 3:52439628-52439650 TCAGACCCAGAGATGGGGCTTGG + Intronic
955051791 3:55418218-55418240 TCTGGATCACATATGGGTCTGGG - Intergenic
957435999 3:80177258-80177280 GCAAGACTACACATGGGGCTAGG - Intergenic
958878074 3:99638300-99638322 TCTTGACCACAGATGGGGAAAGG - Intergenic
959079489 3:101784843-101784865 TCAGGACCACATATGTGGTGGGG + Intronic
959256701 3:104024370-104024392 GCAGGGACACAGATGGAGCTGGG + Intergenic
965246529 3:166278681-166278703 ACAGGAACACGGATGGAGCTAGG + Intergenic
966833182 3:184028721-184028743 GCAGGACCATGGATGGAGCTGGG + Intergenic
967882255 3:194310106-194310128 GCAGCACAACAGGTGGGGCTTGG + Intergenic
968407053 4:350007-350029 TCAGGAGCACAGCTGAGGCCAGG + Intronic
968878892 4:3288544-3288566 TCGGGAGGACAGATGGGGTTTGG + Intergenic
968920245 4:3518742-3518764 TCAGGAACACAGCAGGGGCAGGG - Intronic
969249776 4:5959470-5959492 TCAGGAGCTCAGAGGGTGCTGGG + Exonic
969286400 4:6205075-6205097 TCAGGACGACCTATGGGGCAGGG + Intergenic
969347491 4:6578531-6578553 TCAGGACCTCCAGTGGGGCTGGG + Intronic
969871514 4:10107666-10107688 TGAGGGCCAGAGCTGGGGCTGGG + Intronic
970652379 4:18193104-18193126 TCCGGGGCACAGATGGGACTTGG - Intergenic
972841823 4:42939872-42939894 TCAGGAACACAGATGGAGAATGG - Intronic
973584128 4:52374237-52374259 TTAGGATCACATATGGGTCTGGG - Intergenic
975031358 4:69621848-69621870 GCAGGAACATAGATGGAGCTGGG + Intronic
975344191 4:73275359-73275381 CCATGACCAAAAATGGGGCTTGG - Intergenic
976068692 4:81217864-81217886 TCAGGAACACAGTTGTGTCTGGG + Intergenic
977627751 4:99206138-99206160 CTAGGACCACAGACGGGACTAGG + Intronic
982221909 4:153131799-153131821 TCAGGACTTCAGATAGGGCCTGG - Intergenic
984768633 4:183419097-183419119 TCAGGACCACAGTCCGGGTTTGG + Intergenic
984922138 4:184774563-184774585 TCACTACCACTGATGGGGTTCGG + Intronic
985564751 5:609847-609869 TCAGGGGCAGTGATGGGGCTGGG + Intergenic
985819321 5:2148876-2148898 CGTGGACCACAGATGGGGCAGGG - Intergenic
986532813 5:8757155-8757177 GCAGGAACATAGATGGAGCTGGG - Intergenic
993616364 5:90117355-90117377 TCTGGGCCATAGATTGGGCTGGG - Intergenic
994683095 5:102914278-102914300 CCAGGACCCCAAAAGGGGCTGGG + Intronic
995283798 5:110364234-110364256 GCAAGTACACAGATGGGGCTAGG - Intronic
997527069 5:134560302-134560324 TCAGGATGGCAAATGGGGCTGGG + Intronic
997947022 5:138211838-138211860 TCAGGACCAACGATGGGCCTAGG + Intronic
997962827 5:138335511-138335533 GCAGGGTCACAGATGGGGTTTGG + Intronic
998252360 5:140561705-140561727 GCAGGGGCAGAGATGGGGCTGGG + Exonic
998480629 5:142459694-142459716 CCAGGTCCACAGCTGTGGCTGGG + Intergenic
999226921 5:150033331-150033353 TCAGGACCTGAGATGGAGCCTGG + Intronic
999373689 5:151071723-151071745 TGAGGAACACAGATCAGGCTTGG - Intronic
999878253 5:155832538-155832560 TCAGTCCTAAAGATGGGGCTTGG - Intergenic
1000336582 5:160245833-160245855 TCACCTTCACAGATGGGGCTGGG + Intergenic
1000439155 5:161246872-161246894 ACAGGTCCACAGATGAGGATGGG - Intergenic
1002693799 5:181070634-181070656 CCAAGAGCACAGAGGGGGCTCGG + Intergenic
1003198818 6:3939868-3939890 TCAGCTCCACAGATGGAGCCTGG - Intergenic
1003642531 6:7887810-7887832 GCAGGGCCAGAGCTGGGGCTGGG - Intronic
1006573080 6:35021388-35021410 GCAGGACCACAGATGGGCTCAGG + Intronic
1007260043 6:40557052-40557074 TAAGGCACACAGATGGGGATGGG - Intronic
1007388230 6:41533799-41533821 TCAGGAACCCAGATGAGGCCAGG + Intergenic
1007947848 6:45841729-45841751 TCAGGATCTCATCTGGGGCTGGG - Intergenic
1008487623 6:52052929-52052951 TCTAGAAAACAGATGGGGCTGGG - Intronic
1008516171 6:52321170-52321192 GCCAGAACACAGATGGGGCTGGG + Intergenic
1013087015 6:106865524-106865546 TCAGGACTACACTGGGGGCTGGG + Intergenic
1013488537 6:110621242-110621264 ACGGGACCGCAGGTGGGGCTGGG - Exonic
1016514662 6:144880758-144880780 TCAGGATGAGAGATGGGGTTTGG - Intergenic
1016705003 6:147096689-147096711 TGAGGATGACAGATGGGGATGGG - Intergenic
1018039505 6:159909549-159909571 TCAGGAGCCCAGATGGGGTGTGG + Exonic
1018795138 6:167179721-167179743 TAAGGACCACACCTGAGGCTCGG - Intronic
1018821180 6:167375341-167375363 TAAGGACCACACCTGAGGCTCGG + Intronic
1019625926 7:2015597-2015619 TCAGGCCCACACCTGGGGCAGGG - Intronic
1019667663 7:2259839-2259861 ACTGAACCACAGATGGGACTTGG - Intronic
1019734916 7:2645846-2645868 TCAGGACTACAGCTGGGGTGGGG + Intronic
1020932306 7:14413223-14413245 TCAGCATCCCAGATGGGGCCAGG + Intronic
1021343224 7:19489547-19489569 CCAGGTCCACAGCTGTGGCTGGG + Intergenic
1022041580 7:26586886-26586908 TTAGGAGCAGAGGTGGGGCTGGG - Intergenic
1022332686 7:29395414-29395436 TCAGGACCACAGGTGGGAGGTGG + Intronic
1025042300 7:55657781-55657803 TCAGGAGAACAGCTGGGGCTGGG + Intergenic
1025812710 7:64885249-64885271 CCAGGACCACAGAGAGGGCTTGG - Intronic
1026385223 7:69840039-69840061 TCAGGAACTCTGATGGGGGTGGG + Intronic
1026589723 7:71684325-71684347 TCAGGAAGAAAGAGGGGGCTAGG + Intronic
1027353402 7:77334270-77334292 GCAGGGACACAGATGGAGCTGGG + Intronic
1028378994 7:90176929-90176951 CCAGGTCCACAGCTGTGGCTTGG + Intronic
1029022174 7:97376313-97376335 GCAGGGACACAGATGGAGCTGGG + Intergenic
1029674926 7:102062021-102062043 TGAGGACCACCCACGGGGCTGGG - Intronic
1030059705 7:105612877-105612899 TCAGGTCCCTAGATGGGGCTGGG + Intronic
1031907628 7:127478682-127478704 TCAATTCAACAGATGGGGCTGGG + Intergenic
1032027643 7:128456139-128456161 TGGGGACCCCAGATGGGGCGTGG - Intronic
1033174894 7:139114680-139114702 ACATGACCACAGGTGAGGCTGGG + Intergenic
1033628922 7:143138619-143138641 AGAGGAGCACAGATGGGGCTTGG + Intronic
1035774686 8:2179119-2179141 TCAGGCCCAGAGCTGGGGCGTGG + Intergenic
1036741252 8:11363757-11363779 TCAGGACCACAGATGTGGGAAGG - Intergenic
1036776666 8:11617586-11617608 TCAGGGCCACGGAGGAGGCTTGG - Intergenic
1037422787 8:18721610-18721632 ACAAGACCAGAGATGGGCCTGGG + Intronic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1040614302 8:49018985-49019007 TCAAAAACAGAGATGGGGCTGGG - Intergenic
1042949348 8:74184996-74185018 TCAAGAGCACAGATGGGGTTTGG - Intergenic
1045837390 8:106538086-106538108 CCAGGACCACACATTTGGCTAGG - Intronic
1046156090 8:110291792-110291814 TCAGAAACAAAGATGGGGCCAGG - Intergenic
1047752469 8:127892082-127892104 CCAAGACCACAGTTGGGGCGGGG + Intergenic
1048672227 8:136735839-136735861 TCAGGAACTCAGATGGGAATGGG + Intergenic
1048945818 8:139446071-139446093 TCAGGAAACCAGATGGGGCAGGG + Intergenic
1049428969 8:142550519-142550541 GCAGGACCCCACCTGGGGCTGGG + Intergenic
1050607559 9:7317334-7317356 TCAGAACTAAAGATGAGGCTTGG + Intergenic
1052532540 9:29706339-29706361 TCAGGACCACACAGGGGAATGGG - Intergenic
1052861275 9:33439364-33439386 GCAGAACCAGAGATGGGGGTGGG - Intergenic
1053072578 9:35110026-35110048 TCAGGAACAGAGGTGGGGGTGGG + Exonic
1053507542 9:38655977-38655999 GCAGTCCCACAGTTGGGGCTGGG - Intergenic
1057213174 9:93212401-93212423 TCAGCCAGACAGATGGGGCTGGG - Intronic
1060187298 9:121571522-121571544 TCAGGAACATTGATGGGGATGGG + Intronic
1060822951 9:126671982-126672004 TCACGGCCACAGCTGGGGCTCGG - Intronic
1061403770 9:130382674-130382696 CCAGGATCACAGGTGGGGCTGGG - Intronic
1061486509 9:130923170-130923192 GCGGGACCACAGAAGGTGCTGGG - Intronic
1062278647 9:135742312-135742334 TGGGGACCACACATGGGGCCTGG + Intronic
1062352881 9:136147843-136147865 TCAGGGCCAGAGCCGGGGCTGGG + Intergenic
1062619860 9:137415694-137415716 TCACCATCACAGACGGGGCTGGG + Intronic
1187653649 X:21442846-21442868 GCAGCAACACAGATGGAGCTTGG + Intronic
1189357160 X:40318820-40318842 TCAGGAAAACAGATGGCACTTGG + Intergenic
1190752623 X:53375394-53375416 TGAGGACCTCAGAAGGGGTTTGG + Exonic
1192262976 X:69519343-69519365 TCAGGGCCTCACATGGAGCTGGG - Intronic
1193077537 X:77371016-77371038 TGAGGACCATAGATGTTGCTAGG - Intergenic
1197087994 X:122501938-122501960 TCAGGGCCACAGATGTGTCTTGG - Intergenic
1197725354 X:129772811-129772833 TTGGGACCTCAGAAGGGGCTGGG + Intergenic
1197753628 X:129981086-129981108 TCACGCGCACAAATGGGGCTAGG + Intronic