ID: 1138287646

View in Genome Browser
Species Human (GRCh38)
Location 16:55822467-55822489
Sequence ATGTGGCAGCAGAAGCTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 379}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138287642_1138287646 -6 Left 1138287642 16:55822450-55822472 CCTGAGCCCAAGGGAGGATGTGG 0: 1
1: 1
2: 3
3: 31
4: 306
Right 1138287646 16:55822467-55822489 ATGTGGCAGCAGAAGCTGAGTGG 0: 1
1: 0
2: 4
3: 36
4: 379
1138287637_1138287646 8 Left 1138287637 16:55822436-55822458 CCACAAGGCCTTCTCCTGAGCCC 0: 2
1: 0
2: 5
3: 47
4: 351
Right 1138287646 16:55822467-55822489 ATGTGGCAGCAGAAGCTGAGTGG 0: 1
1: 0
2: 4
3: 36
4: 379
1138287636_1138287646 17 Left 1138287636 16:55822427-55822449 CCGGGCTGTCCACAAGGCCTTCT 0: 1
1: 1
2: 6
3: 42
4: 268
Right 1138287646 16:55822467-55822489 ATGTGGCAGCAGAAGCTGAGTGG 0: 1
1: 0
2: 4
3: 36
4: 379
1138287640_1138287646 0 Left 1138287640 16:55822444-55822466 CCTTCTCCTGAGCCCAAGGGAGG 0: 2
1: 0
2: 1
3: 37
4: 499
Right 1138287646 16:55822467-55822489 ATGTGGCAGCAGAAGCTGAGTGG 0: 1
1: 0
2: 4
3: 36
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138287646 Original CRISPR ATGTGGCAGCAGAAGCTGAG TGG Intronic
902817129 1:18922787-18922809 ATGGGGCAACTGAAGCCGAGTGG + Intronic
903186002 1:21629427-21629449 ATGTGGGTGCAGAACCAGAGCGG + Intronic
903713969 1:25349105-25349127 ATGGGGCAGGAGAAGCAGTGTGG + Intronic
903825983 1:26146075-26146097 AAGTGGCAGCTGAGGGTGAGGGG - Intergenic
903857315 1:26344830-26344852 ATGAGGCAGCAGGAGCACAGGGG + Exonic
903968143 1:27102346-27102368 GTGTGGGAGCAGAAGCTGCCTGG + Intronic
904623063 1:31787131-31787153 CTGTGCAAGCAGAAGCCGAGAGG - Intergenic
904648316 1:31985332-31985354 ATGTGGCAGCAGAGGGAGCGGGG + Intergenic
904777375 1:32918978-32919000 CTGTGGGAGCACAAGCTCAGGGG + Intergenic
904843349 1:33388798-33388820 ATGAGGCAGCAGGTTCTGAGAGG + Intronic
905300608 1:36984124-36984146 ATGTGGTTGCCGAGGCTGAGTGG - Intronic
905698602 1:39994748-39994770 ATGTGGAACGAGCAGCTGAGCGG - Intergenic
905816450 1:40954704-40954726 ATCTGGAAGCAGACTCTGAGAGG + Intergenic
908159158 1:61389305-61389327 AAGTGGCAGGATAAGCTGACAGG - Intronic
909748404 1:79127987-79128009 ATTTGGCAGGACAAGGTGAGGGG - Intergenic
909851376 1:80468678-80468700 ATGTGGAAACATAAGCTGATGGG - Intergenic
910857277 1:91708015-91708037 GTGTGGCATCAGTACCTGAGAGG - Intronic
911417308 1:97590828-97590850 GAGTGGCATCAGAAGCAGAGAGG - Intronic
911853058 1:102842688-102842710 CTGTGGCAGCAGTGGCTAAGGGG + Intergenic
912064754 1:105723351-105723373 ATGTGGCAACAGAATCTCATTGG + Intergenic
912488626 1:110048810-110048832 ATATGGCAGCAGAAGCTTAGGGG + Intronic
913123770 1:115766334-115766356 ATGTGGAAACTGAAGCAGAGAGG - Intronic
913456867 1:119041445-119041467 AAGTGGCAGCAGTAGCTGACTGG + Intronic
913699216 1:121357934-121357956 ATGTGGAAGCTGAAGCATAGAGG + Intronic
914138329 1:144922111-144922133 ATGTGGAAGCTGAAGCATAGAGG - Intronic
916156072 1:161850008-161850030 TTGTGGCAGCAGAGACGGAGAGG - Intronic
916727287 1:167534322-167534344 ATGTGCCACCAGCAGTTGAGGGG + Intronic
916776329 1:167968569-167968591 ATGAGGCAGGAGAAGCTGTCGGG + Intronic
919658570 1:200221389-200221411 ATGTGGCAGTAGAGGTTGTGGGG - Intergenic
920486627 1:206376646-206376668 ATGTGGAAGCTGAAGCATAGAGG + Intronic
920681484 1:208076320-208076342 TTTGGGGAGCAGAAGCTGAGAGG - Intronic
922208234 1:223467465-223467487 CTGTGGCAGCAGCAGTGGAGAGG + Intergenic
923665083 1:235992382-235992404 CTGTGGGGGTAGAAGCTGAGAGG - Intronic
923731074 1:236550730-236550752 ATGTGGCAGCACAAGCCAGGTGG + Exonic
924615288 1:245607264-245607286 GTGTGTCAGCAGAGGGTGAGTGG + Intronic
1063262800 10:4409389-4409411 ATGTGTTTGCAGAACCTGAGGGG - Intergenic
1064035831 10:11912734-11912756 TTGTTGCAGCAGAAGCCCAGAGG - Intergenic
1065183201 10:23147057-23147079 AGGTGGTGGCAGGAGCTGAGCGG - Intergenic
1065408727 10:25397740-25397762 ATGTGGAAGCAGAACCTGGGAGG - Intronic
1065533889 10:26699233-26699255 ATGTGGGAGAAGAGGCTTAGAGG + Intronic
1065899325 10:30191023-30191045 TTGTGGTAGCGGAAGCAGAGAGG - Intergenic
1066388876 10:34963029-34963051 ATGTGACAACAGAAGGTGGGAGG + Intergenic
1068844772 10:61659336-61659358 ATGTGGCAGAATCAGCTGATGGG + Intergenic
1068956364 10:62821465-62821487 ATTTGTCTGCAGAAGCTGAGTGG - Intronic
1068986872 10:63115644-63115666 CTGGTGCACCAGAAGCTGAGTGG + Intergenic
1069748285 10:70729940-70729962 GTGTGCCAGCAGCAGTTGAGTGG + Intronic
1070736381 10:78866353-78866375 ATGTGACAGTAGAGGCTCAGTGG - Intergenic
1071494224 10:86156707-86156729 ATGTGGCAGCAGATGAGGAAGGG + Intronic
1071721123 10:88147186-88147208 ATGAGGCAGCAGCAGCACAGAGG + Intergenic
1073000417 10:100281109-100281131 ATGTGGGAGTATAAGCTAAGTGG + Intronic
1073058826 10:100720501-100720523 ATGAGGCAGCTGAGGCAGAGAGG - Intergenic
1074671410 10:115796244-115796266 ACGTGGCATCAGAACATGAGTGG - Intronic
1074813481 10:117127107-117127129 AAGTGGCAGCAGAAATGGAGAGG - Intergenic
1075057562 10:119230915-119230937 ATCTGGCAGCAGAAGCTGTAGGG + Intronic
1075105712 10:119538778-119538800 GGGTGGCAGCAGGAGCGGAGGGG - Intronic
1075157503 10:119990175-119990197 GTGTGGCATCAGAGGCTGTGGGG + Intergenic
1075610974 10:123854291-123854313 ATAAGGCAGCACAAGCTGAGAGG + Intronic
1076476719 10:130758738-130758760 AGGTGGCTGGTGAAGCTGAGGGG + Intergenic
1076601691 10:131660834-131660856 ATGTGGAAGAAGAAGCTAAGGGG + Intergenic
1077094794 11:794716-794738 ATGTGGCAGCAGGAGAGGTGGGG - Intronic
1077887402 11:6395844-6395866 ATGTGGCAGCAGAAGGAGGCTGG + Exonic
1077983955 11:7332039-7332061 TCCTGGAAGCAGAAGCTGAGAGG + Intronic
1078705413 11:13739175-13739197 ATGTGGAAACTGAAGCTGAGAGG - Intergenic
1079013420 11:16848090-16848112 TAGTGGCAGCAGAAGTGGAGAGG + Intronic
1079312360 11:19378163-19378185 CTGTGACAGCAGAAGCGGATGGG - Intronic
1079478538 11:20857406-20857428 AGCTGGCAGGAGAAGGTGAGTGG + Intronic
1079929762 11:26543272-26543294 ATGTGCCAGCAGGAGATCAGAGG - Intronic
1081813692 11:45927220-45927242 AGGTGGCAGCAGCAGCTAACTGG + Intronic
1082104889 11:48211081-48211103 ATGCAGATGCAGAAGCTGAGTGG + Intergenic
1083538296 11:63491380-63491402 AAGTGGCTGGAGAAGCTGAACGG + Intergenic
1083729135 11:64643515-64643537 GTGTTGCTGCAGAGGCTGAGAGG + Intronic
1083751102 11:64761057-64761079 ATGAGGAGGCAGCAGCTGAGAGG - Intergenic
1084494374 11:69495594-69495616 AGGTGGCACCAGAACCTCAGAGG - Intergenic
1084508634 11:69587448-69587470 ATGGGGAAACAGATGCTGAGGGG - Intergenic
1084592816 11:70100228-70100250 GGGTGGGAGCAGAGGCTGAGCGG + Intronic
1085141107 11:74142660-74142682 ATGAGGCAGAAAAAGCTGAGGGG + Intronic
1085462320 11:76701555-76701577 ATGAGGCAGCAGAGGCTAAGTGG - Intergenic
1085765306 11:79276909-79276931 CTGAGGCAGCAGAAGTTGGGGGG - Intronic
1086068951 11:82777657-82777679 ATGTGGCAGCAGACTTTCAGTGG + Intergenic
1086201452 11:84208060-84208082 ATGTTGAAGCAGAAGCTTATAGG - Intronic
1087220185 11:95538771-95538793 ATCTGGGAGCAGAAACTGGGAGG - Intergenic
1087729140 11:101758718-101758740 ATCTGGCAGCAGAAGCTCTTGGG + Intronic
1087906965 11:103709657-103709679 ATGTTGAAGCAGAGGCTGGGTGG - Intergenic
1087979171 11:104590068-104590090 ACGTGGGAGCAGATCCTGAGGGG - Intergenic
1088044569 11:105432461-105432483 ATGCCTCACCAGAAGCTGAGAGG + Intergenic
1088133435 11:106524218-106524240 ATGTGAAATCAGAAGCTGAGAGG - Intergenic
1088337482 11:108722668-108722690 ATAAGGAAGCTGAAGCTGAGAGG + Intronic
1091749591 12:3014155-3014177 CTGTGGAAGCTGAGGCTGAGAGG - Intronic
1092087711 12:5777468-5777490 AAGTGGCAGCATGAACTGAGGGG + Intronic
1092864938 12:12751884-12751906 ATGTGACGGCAGAAGCAGATTGG + Intronic
1092948340 12:13476909-13476931 TTGTGTCAGCAGAAACTGAAAGG - Intergenic
1094247119 12:28311335-28311357 CTGTGTCAGAGGAAGCTGAGTGG - Intronic
1095526082 12:43127295-43127317 ATGTGGCTGCAGAAACAAAGAGG + Intergenic
1095715240 12:45338336-45338358 AAGGGACAGCAGAAGGTGAGGGG + Intronic
1096614748 12:52825539-52825561 GTCTGACATCAGAAGCTGAGAGG + Intronic
1097688050 12:62709467-62709489 CTGTGCCAGCAGAAGCCCAGAGG - Intronic
1097895932 12:64824880-64824902 ATGCGGCAGGACAAGCTGACCGG + Exonic
1098576230 12:72046396-72046418 AGGTGTCAACAGAGGCTGAGTGG - Intronic
1099072715 12:78066109-78066131 ATATGGCAGGAGAGGCTAAGGGG - Intronic
1099178392 12:79449974-79449996 ATGGGGGAGAAGAAGCTAAGGGG + Exonic
1099616743 12:84945220-84945242 ATGTGGAGGCAGAACATGAGAGG - Intergenic
1101681932 12:106976883-106976905 ATGAGGAAACTGAAGCTGAGAGG - Intronic
1101882626 12:108635847-108635869 ATGAGGAAACTGAAGCTGAGAGG + Intergenic
1102034992 12:109765996-109766018 ATGAGGAAGCAGAGGCCGAGTGG + Intronic
1103250869 12:119498941-119498963 ATTTGGCAGCAAAATCTGACAGG + Intronic
1103576696 12:121882829-121882851 CTGAGGCAGGAGAAGCTGGGAGG - Intergenic
1103937798 12:124485767-124485789 ATGGGGCAGCTGAGGCTGCGAGG - Intronic
1104158795 12:126158945-126158967 ATGTGGCACCAAAAGCAGAGAGG - Intergenic
1104774971 12:131385667-131385689 ACCTGGCAGCAGCTGCTGAGTGG + Intergenic
1105533589 13:21243246-21243268 AGGTGCCAGCAGAGGCTGAGAGG + Intergenic
1106697024 13:32185944-32185966 ATATGTAAGCAGCAGCTGAGTGG + Intronic
1106733499 13:32566547-32566569 ATGTTGAAGGAGAAGCTTAGTGG - Intergenic
1107064486 13:36197793-36197815 ATGTTGCAGCAGGAGCTCTGTGG - Intronic
1109984382 13:69959101-69959123 AAGTGGCAGTGGCAGCTGAGAGG + Intronic
1110506529 13:76294398-76294420 ATATGGTACCAGAAGCTGGGTGG - Intergenic
1111705209 13:91740075-91740097 GTGTGGCGGAAGAAGCTAAGTGG - Intronic
1113582943 13:111441386-111441408 ATGTGCCAGGAGGAGGTGAGGGG - Intergenic
1113653129 13:112051830-112051852 ATGGGGCAGGAGAACATGAGAGG + Intergenic
1115440250 14:33426243-33426265 ATGTGGATGCAGAAGCAGATAGG + Intronic
1116316847 14:43407448-43407470 ATGTGGCAGGAGCATCTGAATGG + Intergenic
1118824626 14:69368935-69368957 AAGTGGAACCAGAAGCTGATGGG - Intergenic
1118935179 14:70281679-70281701 GTGAGGCACCAGAAGCTGAGAGG + Intergenic
1118956496 14:70487915-70487937 ATGTGAAAGCAGGAGCAGAGGGG + Intergenic
1119763427 14:77171596-77171618 ATGTGGCAGCTGCTTCTGAGGGG - Intronic
1120055720 14:79921672-79921694 CTGGGGAAGCAGAAGCTTAGGGG + Intergenic
1122534302 14:102451500-102451522 ATTTGGCAGCAAAACCTGACCGG + Intronic
1123025960 14:105424151-105424173 CTGAGGCAGGAGAAGCTCAGTGG - Intronic
1124723219 15:32131884-32131906 AGGTGTCAACAGAGGCTGAGTGG - Intronic
1128502124 15:68233910-68233932 ATCTGGCTGAAGAAGCTGGGAGG + Intronic
1128719751 15:69939760-69939782 TTGGGGCAGCAGCAGCAGAGAGG + Intergenic
1129282968 15:74500591-74500613 ATGTGGGGGCAGATTCTGAGGGG + Intergenic
1129718339 15:77864632-77864654 CTGTGGCTGCAGAAAGTGAGAGG - Intergenic
1129799598 15:78404090-78404112 ATGAGGAAGCTGAAGCAGAGAGG - Intergenic
1130162214 15:81413445-81413467 AGGGGTCAGCATAAGCTGAGGGG - Intergenic
1130460582 15:84156233-84156255 CTGTGGCTGCAGAAAGTGAGAGG + Intergenic
1130539145 15:84809450-84809472 CTGTGGCAGCAGTTGCTGGGAGG + Intergenic
1131142275 15:89986934-89986956 ATCAGGCAGCTGAACCTGAGTGG + Intergenic
1132235354 15:100216012-100216034 TTGTGCCAGCAGAGTCTGAGCGG + Intronic
1132548719 16:545424-545446 CTGTGGCTGGAGACGCTGAGGGG - Intronic
1132677346 16:1126266-1126288 ACATTGCAGCAGAGGCTGAGGGG + Intergenic
1134230123 16:12422507-12422529 ACTTGCCAGAAGAAGCTGAGAGG - Intronic
1135524853 16:23206402-23206424 AGATGGCAGCAGAGCCTGAGGGG - Intronic
1136228819 16:28875497-28875519 AGGTGGGGGCTGAAGCTGAGGGG - Intergenic
1136286860 16:29249212-29249234 ATGGGACAGCAGAGGCAGAGTGG - Intergenic
1137584921 16:49658625-49658647 ATATGGCAGCAGCAGCAGAGAGG + Intronic
1138270934 16:55695388-55695410 ATGTGGCCACAGAAGGTGGGTGG + Exonic
1138280881 16:55771395-55771417 GTGTGGCAGCAGCAGCTGAGTGG - Intergenic
1138287646 16:55822467-55822489 ATGTGGCAGCAGAAGCTGAGTGG + Intronic
1139022546 16:62768345-62768367 ATGTGGCAGAGGAAGATGATAGG + Intergenic
1139093405 16:63676318-63676340 ATGGGGCAGCTGAGTCTGAGAGG + Intergenic
1139444923 16:66991742-66991764 ATGTGGAAGCTGAAGCTCAAAGG - Intronic
1139883505 16:70192776-70192798 CTGTGCCAGCAGAGGCTGTGGGG - Intergenic
1140369005 16:74402743-74402765 CTGTGCCAGCAGAGGCTGTGGGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141196948 16:81867206-81867228 ATGCCACAGCAGAAGCTGGGAGG + Intronic
1141809524 16:86365696-86365718 CTGTGGCAGCAGCTGCTGTGGGG + Intergenic
1142546610 17:708333-708355 TTGTGGTAGCCGAAGCAGAGAGG + Intronic
1142625552 17:1189549-1189571 ATGTGCCAGATGAAGCTGAAAGG - Intronic
1142692960 17:1617860-1617882 CTGTGGCAGCTGAAGATGGGAGG + Intronic
1142759555 17:2034811-2034833 ATGGGGCAGCAGCAGGGGAGGGG - Intronic
1143023611 17:3928982-3929004 TTGAGGCAGAGGAAGCTGAGCGG - Intronic
1143845898 17:9772511-9772533 AGGTGGCAGAGGAAGCTGAGTGG + Intronic
1144204456 17:12969750-12969772 ACCTGGTGGCAGAAGCTGAGCGG - Intronic
1145405695 17:22589480-22589502 GTGTGGCAGCACAAGTTCAGTGG + Intergenic
1146052931 17:29567189-29567211 AAGTGGGAGCAGAGGGTGAGAGG + Intronic
1146891182 17:36507406-36507428 ATGAGGGAGCAGATGCTGATGGG + Exonic
1146948240 17:36888686-36888708 CTGGGGCAGCTGAAGCTGGGAGG - Intergenic
1147899551 17:43775056-43775078 ATGAGGCAGGAGAAGCTGGCAGG - Intronic
1147959761 17:44159698-44159720 TTGTGGTAGCTGAAGCAGAGAGG + Intronic
1148480277 17:47955535-47955557 AAGTAGCAAGAGAAGCTGAGGGG + Intronic
1148686722 17:49505244-49505266 ATGTGGAAGCAGAAGCAGAAAGG - Intronic
1150007550 17:61479186-61479208 GTGTGGAAGCAGAGCCTGAGCGG + Intronic
1150239065 17:63617499-63617521 AGGTGGAAGCAGAAGCGAAGAGG + Intergenic
1151231543 17:72688703-72688725 ATGTAGCAGCAGGACCTCAGGGG + Intronic
1151412040 17:73937366-73937388 ATGTGGCAGGAGTAGTTGGGTGG + Intergenic
1151903889 17:77035301-77035323 ATGAGGCGGCAGAGGCTGAGAGG + Intergenic
1152428937 17:80236740-80236762 ATGTGGCAGCATAAGCAGGTGGG - Intronic
1152645724 17:81467722-81467744 ATGTGGCAGCAGGATCAGCGGGG + Intergenic
1152932219 17:83115747-83115769 AGGTGGCAGGAGGGGCTGAGGGG + Intergenic
1153617394 18:6947441-6947463 ATGTGGAAGCCGAGGCTCAGAGG - Intronic
1153672080 18:7421015-7421037 AGGGGGCAAAAGAAGCTGAGAGG + Intergenic
1153988257 18:10372490-10372512 AGGTGGCAGCAGAAGCCAGGGGG - Intergenic
1154932359 18:21013319-21013341 AGGTGTCAGTAGAGGCTGAGTGG - Intronic
1155041506 18:22069118-22069140 ATGTGTAAGCAGAAGCTGTAGGG - Intergenic
1155209095 18:23586001-23586023 ATGTGGCACCAGAAGAAGGGAGG - Intronic
1155499054 18:26469041-26469063 GAGGGGCAGCAGAAGCTGAAGGG - Intronic
1157056942 18:44240816-44240838 ATTAGGCAGCAGAAGCTTTGTGG - Intergenic
1159004802 18:63002409-63002431 ATGTGGCAGGAGGAGTGGAGGGG + Intergenic
1159014188 18:63088357-63088379 ATGGGGTATCAGAAGCTGATCGG - Intergenic
1160814716 19:1029603-1029625 ATGAGGAAGCGGAGGCTGAGTGG + Intronic
1160933635 19:1582687-1582709 TTCTGGGAGAAGAAGCTGAGCGG - Exonic
1161266823 19:3367958-3367980 ATGTGGGAGCTGGTGCTGAGGGG + Intronic
1161898312 19:7099209-7099231 ATGGGGAAGCCGAAGCTGGGCGG + Intergenic
1164866124 19:31605852-31605874 CTGTGGGCACAGAAGCTGAGAGG + Intergenic
1165153682 19:33774980-33775002 CTGAGACAGCAGATGCTGAGGGG + Intergenic
1165565770 19:36726469-36726491 AGGTGTCAGTAGAAGGTGAGTGG - Intronic
1166173744 19:41050711-41050733 ATGAGGCAGCTGAGGCTCAGTGG - Intergenic
1166748099 19:45151532-45151554 CTGTGGCAGGAGAGGCTGCGGGG - Exonic
1166851263 19:45762545-45762567 CTGAGGCAGGAGAATCTGAGAGG - Intronic
1167391378 19:49197110-49197132 AAATAGCAGCAGAGGCTGAGTGG - Intronic
1168274534 19:55270006-55270028 CTCGGGCAGCAGGAGCTGAGGGG + Intronic
1168284625 19:55324737-55324759 ATTTGGCAGCAGAAGGGGTGAGG - Intronic
925627196 2:5853025-5853047 ATGTCCCAGCTGAAGCTGAGAGG - Intergenic
925895695 2:8470325-8470347 ATGTTTCAGAAGAAGCAGAGAGG - Intergenic
925913527 2:8588304-8588326 ATGAGGCTGCAGAAGCTGGGGGG - Intergenic
926442866 2:12908497-12908519 ATGTTGCAGCTGAGGTTGAGTGG - Intergenic
926761714 2:16284121-16284143 ATGTGGGAGGAGAGGCAGAGGGG - Intergenic
928679106 2:33680772-33680794 GGGTGGCAGCACTAGCTGAGTGG + Intergenic
932068260 2:68589609-68589631 AGGGGGCAGTAGAAGCAGAGAGG + Intronic
936008605 2:108910677-108910699 ATGTGAGAGCAGAAGCAGCGAGG + Intronic
936613289 2:114022945-114022967 ATGAGCAAGCAGAGGCTGAGAGG + Intergenic
936923954 2:117717837-117717859 CTGTGGCAGCAGAAAATGTGAGG + Intergenic
937272624 2:120663010-120663032 ATGAGGAAGCTGAAGCTGAGTGG - Intergenic
937422799 2:121772563-121772585 ACGTGGCAGAGGAAGCTGAAGGG - Intergenic
938138729 2:128779878-128779900 ATGTGGCTGCAGAGGCAGATGGG - Intergenic
940558736 2:155266407-155266429 ATGTAACAGCAGATCCTGAGGGG + Intergenic
941431664 2:165421479-165421501 GTGTGGTAGCAGAAGCTGAGAGG - Intergenic
944766688 2:202871599-202871621 AGGAGGCAGCAGAAGCTTACCGG + Intronic
947829383 2:233128044-233128066 GGGTGGCAGCAGGAGGTGAGCGG + Intronic
948048146 2:234958986-234959008 GAGTGGCCGCAGATGCTGAGAGG + Intronic
948467067 2:238157786-238157808 ATGTGGCAGCAGGGACTGAAAGG - Intergenic
948698282 2:239745127-239745149 TTGCGGCAGCAGCAGCTTAGAGG + Intergenic
1168890493 20:1292810-1292832 AGGTGGCAGCAGAAAATGGGAGG - Intronic
1169330678 20:4713817-4713839 ATGTGGCAGCTGAAGTGGAGGGG + Intergenic
1170583423 20:17716060-17716082 ATGTGGCCCAAGAAGGTGAGGGG + Intronic
1170735863 20:19013699-19013721 ATCTAGCAGCAGAGGCTGCGGGG + Intergenic
1171071475 20:22072881-22072903 TGGTGTCAGCAGAGGCTGAGTGG - Intergenic
1171088613 20:22262887-22262909 ATGTGAAAGCTGAAGCTCAGAGG - Intergenic
1171164341 20:22957207-22957229 ATGTCCCTGCAGAGGCTGAGAGG + Intergenic
1171368071 20:24640233-24640255 TTGTGGCAGGAGAATCTGGGAGG + Intronic
1172040433 20:32040776-32040798 AAGTGGCGGCAGCAGCTGATAGG - Intergenic
1172224363 20:33295505-33295527 ATGAGGCAGGAGAATCAGAGAGG + Intronic
1172938202 20:38636003-38636025 TGGTGACAGCAGAAGCTCAGAGG + Intronic
1174371303 20:50089994-50090016 AGGTGCCAGCAGCAGCAGAGGGG + Intronic
1175540297 20:59743908-59743930 AGGGGGCAGCAGGAGGTGAGTGG - Intronic
1176146385 20:63567367-63567389 ATGTGGGAGAAGAAGCCGACCGG + Exonic
1176204140 20:63879035-63879057 AGGTGGCGGCAGCAGCTGTGAGG - Intronic
1178147626 21:29758078-29758100 ATGTGGCTCCAGTAGCTGAAAGG - Intronic
1180626856 22:17199350-17199372 ATGTGGGAGAAGTTGCTGAGCGG - Intronic
1181277371 22:21695275-21695297 ATGTGGGAGCAGCAGGTGGGAGG + Intronic
1182326898 22:29520036-29520058 TTGTGGGTGCAGAAGCTGGGTGG - Exonic
1183049087 22:35246198-35246220 CTGTGCCAGCAAAGGCTGAGTGG - Intergenic
1183107939 22:35627965-35627987 AGGGGGCAGGAGAAGCAGAGAGG + Intronic
1183412051 22:37660578-37660600 AGGTGGCAGCAGAGGCTAATTGG + Intronic
1183412537 22:37663670-37663692 AGGTGGCAGCAGAGGCTGACTGG - Intronic
1185163476 22:49243696-49243718 AAGTGGCTGCAGACACTGAGTGG - Intergenic
1185346963 22:50314668-50314690 AAGTCGCAGCAGAACCTGAGGGG + Exonic
949513659 3:4788118-4788140 AATTGGCAGAAGAAACTGAGAGG + Exonic
950006137 3:9692137-9692159 ATGTGGTAGGAGAAGCTGTTTGG + Intronic
950246210 3:11421332-11421354 AAGTGGCAGCAGCATTTGAGAGG - Intronic
951669256 3:25162007-25162029 ATGTATCAGCAGAACCTGTGTGG + Intergenic
952168207 3:30775225-30775247 ATTTGGCGGCAGAAGGGGAGAGG - Intronic
953927176 3:46988391-46988413 AGGTGGGAGCAGAAACTGGGAGG + Intronic
955741401 3:62094803-62094825 AAGTTTCAGCAGCAGCTGAGGGG - Intronic
957625974 3:82652160-82652182 ATGTGTCAGAGGAATCTGAGAGG + Intergenic
959575652 3:107930174-107930196 ATGTATAAGCAGAAGCTCAGGGG + Intergenic
963712961 3:148768315-148768337 AGGTGTCAAAAGAAGCTGAGTGG + Intergenic
966969520 3:185030400-185030422 GTGTGTTTGCAGAAGCTGAGGGG + Intronic
967456265 3:189690007-189690029 GTGTGGCAGGAGGAGCAGAGAGG - Intronic
967534045 3:190582086-190582108 ATGTGGAAACAGATTCTGAGAGG - Intronic
967635818 3:191801679-191801701 CTGTGGCAGTAGAAGTTGGGTGG - Intergenic
967743543 3:193029426-193029448 ATGTGGAGACAGAAGCCGAGGGG + Intergenic
967866569 3:194194808-194194830 ACATTGCAGCAGAAACTGAGGGG + Intergenic
968165359 3:196460382-196460404 AGGTAGCAGCAGCAGCTGGGAGG + Intergenic
968744765 4:2353903-2353925 ACGGGGCAGCAGAAGCTGGCTGG - Intronic
968896535 4:3407231-3407253 CCGTGGCGGCAGCAGCTGAGGGG + Intronic
969407936 4:7007278-7007300 AGGTGGCAGGAAAAGCAGAGGGG + Intronic
971997858 4:33990033-33990055 ATGTGGCAGCACAAGTTCAGTGG - Intergenic
972581349 4:40398270-40398292 AGGAAGCTGCAGAAGCTGAGGGG - Intergenic
973095609 4:46195512-46195534 ATGTGGTCTTAGAAGCTGAGAGG + Intergenic
974229104 4:59086523-59086545 ATGTCTCAGCAGTAGCTGAAAGG + Intergenic
974443887 4:61954267-61954289 ATCTGGCAGGAGATGCTGATGGG - Intronic
975811001 4:78169447-78169469 AAGTGGCATCTAAAGCTGAGAGG - Intronic
976679989 4:87745799-87745821 GTGTGGGAGGGGAAGCTGAGGGG - Intergenic
977753179 4:100633877-100633899 ATGTCACAGCTGAAGCAGAGAGG + Intronic
977836014 4:101647227-101647249 ATGTTATAGCAGAAGCTCAGTGG + Intronic
978202582 4:106039845-106039867 ATGTGGCAGTATAAGATGACAGG - Intergenic
978903027 4:113975632-113975654 ATGTGGCAACAGATTCTAAGAGG - Intronic
979150804 4:117311637-117311659 AAGAGGCAGAAAAAGCTGAGAGG + Intergenic
980647826 4:135666323-135666345 AAGTGGCAGGAATAGCTGAGAGG - Intergenic
980914947 4:139025291-139025313 AAAGGGCAGGAGAAGCTGAGGGG - Intronic
981337723 4:143585836-143585858 AGGAGTCAGCAGAAGGTGAGAGG - Exonic
986029512 5:3881683-3881705 GTTTTGCAGCAGAAGCTGAGGGG - Intergenic
987160534 5:15137175-15137197 TGGTGGCAGCAGGAGCAGAGAGG + Intergenic
987528439 5:19082616-19082638 ATGTGGATGCTGAAGTTGAGAGG - Intergenic
990288912 5:54329009-54329031 ATGTGACAGCAGAGGCAGAGTGG - Intergenic
991077653 5:62559455-62559477 AAGCAGCAGCAGAATCTGAGAGG - Intronic
991257484 5:64631035-64631057 ATGTGGCTGGAGAAGATTAGCGG + Intergenic
992157989 5:73973440-73973462 ATGTGACAACAAAAGCAGAGAGG + Intergenic
992218796 5:74551308-74551330 ATGTGACAGCAGAAATTGAAGGG - Intergenic
993007856 5:82447418-82447440 ATGAGGAAACAGATGCTGAGAGG - Intergenic
993083865 5:83339033-83339055 ATGAGGCAACACAAGCTGTGGGG - Intronic
993216846 5:85035624-85035646 TTGGGGCAGAAGAATCTGAGGGG - Intergenic
993630382 5:90279228-90279250 AAGTAGGAGCTGAAGCTGAGAGG - Intergenic
994722109 5:103392295-103392317 ATGAAGAAACAGAAGCTGAGAGG - Intergenic
995751204 5:115455091-115455113 GTGAGGCATCTGAAGCTGAGAGG - Intergenic
995993622 5:118272318-118272340 AGGTGTCAACAGAGGCTGAGTGG + Intergenic
996299083 5:121960370-121960392 AGGTGGCAGCAGTTGCTGGGTGG - Intergenic
996472901 5:123880372-123880394 ATGTGCCACCAGAAACTTAGTGG + Intergenic
996947456 5:129087828-129087850 ATGAGGAAGCAGAAGCTGTGTGG + Intergenic
997528975 5:134570638-134570660 TTGTGGCAGCCGCTGCTGAGAGG - Intronic
998860865 5:146442709-146442731 ATGTGGCAGAAGAGGGCGAGAGG + Intergenic
1000366868 5:160500008-160500030 ATGAGGAAGCAGAAGCTATGAGG + Intergenic
1001168889 5:169398042-169398064 ATGTGGGAGAAGTAGATGAGAGG + Intergenic
1001369626 5:171185461-171185483 AAGTGGCAGCAGAGTTTGAGAGG - Intronic
1001373251 5:171228537-171228559 AAGTGGCAGCAGAGTTTGAGAGG + Intronic
1001778272 5:174345387-174345409 ATGTGGCCACAGAGGCCGAGAGG - Intergenic
1002109638 5:176899686-176899708 ATGTGGGAGCACAAGCGGAAGGG + Intergenic
1002280441 5:178126872-178126894 AGGTGGCAGCAGACGCTAGGAGG - Intergenic
1002549230 5:179974661-179974683 GTGTGACAGCAGACGCTGTGGGG + Intronic
1002590340 5:180286950-180286972 ATGTTTCAGCAGTTGCTGAGTGG - Intronic
1002968988 6:1995134-1995156 ATGGGGCAGCAGAAACTGAGGGG + Intronic
1003124632 6:3346524-3346546 GTGTGGCAGCAGATACGGAGGGG - Intronic
1003240093 6:4337232-4337254 TTGTGGTAGCCGAAGCAGAGAGG - Intergenic
1003599698 6:7505625-7505647 GTGTGGCTGCTGAAGCAGAGAGG - Intergenic
1003965918 6:11251974-11251996 AAGTGCAAGCAGAAGGTGAGGGG - Intronic
1004219155 6:13730808-13730830 ATGGGGCATCAGAGCCTGAGCGG - Intergenic
1005885221 6:30092279-30092301 ATGTGGCAGGAGGAGCAGGGAGG + Intergenic
1006097292 6:31664077-31664099 ATGAGGCAGGAGGAGCTGGGGGG - Exonic
1006901173 6:37502705-37502727 ATGTGGAAGCTGAAGCTTACGGG - Intergenic
1007629413 6:43264563-43264585 AAGTGAGGGCAGAAGCTGAGAGG + Intronic
1008439795 6:51520074-51520096 AAGTGCCAGCAGAAGCTGCAGGG - Intergenic
1010566275 6:77418117-77418139 ATATGCCAGAAAAAGCTGAGTGG + Intergenic
1010637028 6:78272710-78272732 ATTTGGCAGTAGAAAATGAGAGG - Intergenic
1010653706 6:78486250-78486272 TTCTGTTAGCAGAAGCTGAGAGG - Intergenic
1011327883 6:86171187-86171209 GGGTGGAAGCAGTAGCTGAGTGG - Intergenic
1011805959 6:91072654-91072676 ATGTGGCAGCAGGAGAAAAGTGG - Intergenic
1011838100 6:91458682-91458704 ATCTTGCAGTAGAAGCTGGGTGG + Intergenic
1011927858 6:92670760-92670782 ATCTGATAGCAGAAGGTGAGAGG - Intergenic
1012128627 6:95462654-95462676 ATGTGGCATCACAAGGTGAGGGG + Intergenic
1012367238 6:98456883-98456905 AGGTGGCAGAAGAAGAGGAGGGG - Intergenic
1013826402 6:114215877-114215899 CTGTGGCCCCAGAAGATGAGTGG - Intronic
1014136587 6:117896564-117896586 AGGCCTCAGCAGAAGCTGAGCGG + Intergenic
1014153779 6:118088641-118088663 AGGTGGCAGTAGAAGGTGTGAGG + Intronic
1018324867 6:162655764-162655786 AGATGGTAGCAGAAGCTCAGAGG - Intronic
1018365935 6:163119920-163119942 ATGTGGAAGCAGAAAATGAATGG - Intronic
1019707704 7:2504486-2504508 GTTTGGCAGCAGAACCTCAGGGG - Intergenic
1022479358 7:30733077-30733099 GTGTGCAAGCAGAGGCTGAGTGG - Intronic
1022519281 7:30995412-30995434 AGGAGGCAGCAGAGGCTGAGTGG - Intergenic
1022547739 7:31204407-31204429 ATGAGGCAGCAGAATCTAAGTGG + Intergenic
1023273523 7:38493220-38493242 ATGTGGCAGCCAGAGCTCAGGGG - Intronic
1023938852 7:44757568-44757590 ATGTGGGAGGAGCTGCTGAGGGG - Intronic
1023982842 7:45079786-45079808 AGGTGACATCAGAAGGTGAGGGG + Intergenic
1024594178 7:50918212-50918234 CTGTAGCAGCAGAAGCTAACTGG + Intergenic
1024677908 7:51654524-51654546 ATGTGGCCAGAGAAGGTGAGAGG - Intergenic
1024985934 7:55193187-55193209 AGGTGGCAGAAGAAGCTTAATGG + Intronic
1025708945 7:63890551-63890573 CTGTGGGAGCAGCAGGTGAGTGG + Intergenic
1028066388 7:86390668-86390690 AGGTGTCAACAGAGGCTGAGTGG - Intergenic
1029286374 7:99468691-99468713 CTGGGGCAGGGGAAGCTGAGGGG + Intergenic
1029740210 7:102487316-102487338 ATGTGGCTTGAGGAGCTGAGGGG - Intronic
1029758206 7:102586490-102586512 ATGTGGCTTGAGGAGCTGAGGGG - Intronic
1029776144 7:102685568-102685590 ATGTGGCTTGAGGAGCTGAGGGG - Intergenic
1032081471 7:128860565-128860587 TGGAGGCAGCCGAAGCTGAGGGG - Intergenic
1036097725 8:5741938-5741960 ATGGAGCAGCAGAGCCTGAGAGG + Intergenic
1036747448 8:11420009-11420031 ATGGGGCAGCAGCTGCGGAGGGG - Intronic
1036758545 8:11490389-11490411 CTCTGGCAGCAGAAGATGGGAGG - Intergenic
1036899050 8:12658284-12658306 AGGTGGCAGCAGTCACTGAGGGG + Intergenic
1037407304 8:18556466-18556488 ATGTGGCAGCAGAGGCACATTGG - Intronic
1037689768 8:21172037-21172059 ATTTGGCAGCAGGAGGTGAGAGG - Intergenic
1039061058 8:33572501-33572523 AAGTGTCAGCAGAGGCTGGGAGG + Intergenic
1041180214 8:55239536-55239558 GTGGGGCAGCAGAAGGAGAGTGG - Intronic
1043316012 8:78922981-78923003 ATCCGGCACCAGAAGCAGAGTGG - Intergenic
1044257897 8:90087251-90087273 ATGTAGAAGTAGAAGCTGAATGG + Intronic
1045188117 8:99858336-99858358 ATGGGGCAGCAGCGGCTGAGTGG + Intronic
1046128905 8:109943413-109943435 ATGAGGTAGCAGAAGCCTAGTGG - Intergenic
1046885192 8:119359059-119359081 ATGTGGAAGGAGAAGGGGAGGGG + Intergenic
1047215867 8:122875700-122875722 ATGTGGAAACAGAAGCTGCCTGG + Intronic
1047537579 8:125733742-125733764 ATGTGGAAGCTGAAGCTTAGCGG - Intergenic
1047893325 8:129337329-129337351 AAGTGGCAGCATAAAGTGAGAGG - Intergenic
1048194614 8:132322034-132322056 GTGTGGCAGAAGAAGGAGAGCGG + Intronic
1048591907 8:135828135-135828157 AGGTGGGAGCAGAGGTTGAGGGG - Intergenic
1049159404 8:141087634-141087656 GTGTGGCAGCAGGAGGTGGGTGG + Intergenic
1050264848 9:3879426-3879448 CTGTGGACGCAGGAGCTGAGAGG - Exonic
1050327262 9:4509519-4509541 ATGTGGCTGCAGAAGAACAGGGG + Intronic
1050405826 9:5307757-5307779 ATGGGGCTGTAGAAGCTCAGAGG - Intergenic
1050418470 9:5438085-5438107 ATGAGGCAGAGGAAGCGGAGTGG + Intergenic
1051658214 9:19402814-19402836 ATGTGGAAGCAGAAGGGCAGGGG - Intergenic
1052778265 9:32754879-32754901 ATGGGGCAGCAGTAGGTGATGGG - Intergenic
1053185153 9:36009722-36009744 ATGAGGCAGGAGAAGCAGAAAGG + Intergenic
1053279814 9:36812667-36812689 GTGGGTCAGCAGGAGCTGAGGGG - Intergenic
1053307449 9:36994545-36994567 CTGTGGCAGCTGAAGCTAATGGG - Intronic
1053342443 9:37349060-37349082 ATGGGCCAGCAGAACATGAGAGG - Intronic
1055105206 9:72504959-72504981 CTGTGGCAACAGGAGGTGAGAGG - Intergenic
1055434936 9:76283183-76283205 AAGTAGCAGCAGAATTTGAGAGG + Intronic
1055588721 9:77786525-77786547 TTCTGGAAGCAGCAGCTGAGAGG + Intronic
1056398930 9:86208426-86208448 ATGGGGCATTAGAATCTGAGAGG + Intergenic
1057010917 9:91600597-91600619 ATTTTCCAGCAGAAGCCGAGGGG - Intronic
1057151094 9:92796668-92796690 GTGTGGAAGCAGAGGCTGTGTGG - Intergenic
1057558824 9:96111352-96111374 CTGTGGAAGCAGAAAGTGAGGGG + Intronic
1057796700 9:98162943-98162965 ATGGGGCAGGATAAGATGAGTGG - Intronic
1057955108 9:99401136-99401158 ATGTGGAAGGAGAATGTGAGAGG - Intergenic
1058058651 9:100473593-100473615 GTGTAGCAGCAGAAGGCGAGCGG - Exonic
1059226186 9:112675225-112675247 CTGAGGCAGCAGAATCTAAGAGG - Intergenic
1059356943 9:113707298-113707320 AAGTGGCTGCTGAAGCTCAGAGG + Intergenic
1059395589 9:114032254-114032276 CCGTGGCAGCAGAATCTGACAGG + Intronic
1059565046 9:115375827-115375849 ATGTGACAGCAGAACTTGATGGG - Intronic
1059773245 9:117447882-117447904 ATGGGGCAGCCGAAGCAGAGAGG - Intergenic
1060394337 9:123305086-123305108 ATGAGGCAGCAGAAGCACAGAGG + Intergenic
1061312912 9:129775632-129775654 ACATTGCAGCAGCAGCTGAGAGG + Intergenic
1061542888 9:131287764-131287786 ACGTGGAAGCTGAGGCTGAGTGG - Intergenic
1062487249 9:136785294-136785316 TTGTGGTAGCTGAAGCAGAGAGG + Intergenic
1062639622 9:137511872-137511894 TTGTGGTAGCTGAAGCAGAGAGG - Intronic
1186115184 X:6297879-6297901 AGGTAGCAGCAGAAGCTATGAGG + Intergenic
1186650262 X:11551943-11551965 ATGAAGCAGCACAAACTGAGTGG - Intronic
1188524196 X:31071721-31071743 ATGAGGCTGCAGAACCTGCGCGG - Exonic
1190409922 X:50126305-50126327 ATGTGTCAACAGAAGATGAGGGG - Intergenic
1192365658 X:70470803-70470825 ATTTGGAAGCAGAGGCTTAGAGG + Intronic
1193836203 X:86347930-86347952 AACTGGAAGCAAAAGCTGAGAGG - Intronic
1193912145 X:87318309-87318331 ATTTGCCAGCAGTAGCTGTGTGG - Intergenic
1195173717 X:102294763-102294785 TTATGTCAGCAGAAGTTGAGTGG + Intergenic
1195185148 X:102392330-102392352 TTATGTCAGCAGAAGTTGAGTGG - Intronic
1197113418 X:122802844-122802866 ATTTGGCAGAAAAAGCTGATTGG + Intergenic
1197232849 X:124024676-124024698 ATGAGGTAGCAGAGGCTGTGAGG - Intronic
1197664858 X:129212552-129212574 CTGTGGCACCTGATGCTGAGGGG - Intergenic
1197952255 X:131910207-131910229 ATGTGACAGAAGAAGCAGATTGG - Intergenic
1197971641 X:132120692-132120714 ATGTGACAGCAGGAGATGTGGGG + Intronic
1200755297 Y:6985028-6985050 ATGAGGAAGCAGAAGTGGAGAGG - Intronic
1201481754 Y:14447081-14447103 AGGTAGCAGCAGAAGCTATGAGG - Intergenic
1202378666 Y:24258947-24258969 CTGTGGCTGCAGAAAGTGAGAGG - Intergenic
1202492116 Y:25411174-25411196 CTGTGGCTGCAGAAAGTGAGAGG + Intergenic