ID: 1138288301

View in Genome Browser
Species Human (GRCh38)
Location 16:55826412-55826434
Sequence CTCACGACATTGTAGTGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 3, 1: 0, 2: 0, 3: 3, 4: 42}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138288295_1138288301 25 Left 1138288295 16:55826364-55826386 CCTTGGACTGGGAGGTTTAAGCC 0: 2
1: 0
2: 2
3: 28
4: 270
Right 1138288301 16:55826412-55826434 CTCACGACATTGTAGTGGGTAGG 0: 3
1: 0
2: 0
3: 3
4: 42
1138288298_1138288301 4 Left 1138288298 16:55826385-55826407 CCTGGAAATGGACTTGATAGTTA 0: 1
1: 1
2: 1
3: 9
4: 122
Right 1138288301 16:55826412-55826434 CTCACGACATTGTAGTGGGTAGG 0: 3
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138288301 Original CRISPR CTCACGACATTGTAGTGGGT AGG Intronic
906313289 1:44769155-44769177 CTCACCACATTGTATTTGCTTGG - Intergenic
908382515 1:63609996-63610018 CTCAGTTCATAGTAGTGGGTTGG + Intronic
910523131 1:88146267-88146289 CTCATGACATGGTAGTGTTTAGG - Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916553894 1:165876116-165876138 TTTAGGACATTGTAGTAGGTGGG + Intronic
921871171 1:220141481-220141503 CTAATAACATTGGAGTGGGTGGG + Intronic
1074051689 10:109886505-109886527 CTCACGACAGTCAAGTGGCTTGG - Intronic
1075487904 10:122841114-122841136 CTGACCACATTGGGGTGGGTAGG - Intronic
1091579666 12:1776357-1776379 CACAAGACCCTGTAGTGGGTAGG + Intronic
1091672554 12:2462671-2462693 CTCACATCATTTTAGTGGGTGGG - Intronic
1096202919 12:49698575-49698597 CTCACAACAAAGTTGTGGGTTGG - Intronic
1110313919 13:74083054-74083076 CTGACAACATTGAAATGGGTTGG + Intronic
1114728891 14:24969499-24969521 CTATAGACATTGTTGTGGGTAGG + Intronic
1126240488 15:46437061-46437083 CTCACTTCATTGTAGTGGTCTGG + Intergenic
1128477820 15:68012519-68012541 CTCATGAATTTGTTGTGGGTAGG - Intergenic
1136180992 16:28551912-28551934 CTCAGGACATTGTACTAAGTAGG + Intergenic
1138275001 16:55727978-55728000 CTCACGACATTGTAGTGGGTAGG - Intergenic
1138280187 16:55767226-55767248 CTCACGACATTGTAGTGGGTAGG - Intergenic
1138288301 16:55826412-55826434 CTCACGACATTGTAGTGGGTAGG + Intronic
1140242010 16:73211090-73211112 ATCAGGACAATGTCGTGGGTTGG + Intergenic
926609073 2:14927210-14927232 CTCACGTCATTGTGGAGGCTTGG - Intergenic
928851426 2:35752019-35752041 CTCTAGCCATTCTAGTGGGTGGG - Intergenic
933979674 2:87539594-87539616 CTCAGGACACTGTTGTGGGGTGG - Intergenic
936314145 2:111411197-111411219 CTCAGGACACTGTTGTGGGGTGG + Intergenic
936666368 2:114601174-114601196 CTAATGACGTTGTAATGGGTGGG + Intronic
943420140 2:187659265-187659287 TTCACGCCATTGTAGCGGGGAGG + Intergenic
943493060 2:188580987-188581009 CTCATCACATTGTATTTGGTGGG + Intronic
948015722 2:234689189-234689211 TTCTCGACATGGTGGTGGGTGGG - Intergenic
1176415277 21:6471137-6471159 CCCACCACATTGTACTGGGAAGG + Intergenic
1177434494 21:21033564-21033586 CTCACGCCATTGTTTTGGGGGGG - Intronic
1179690777 21:43079470-43079492 CCCACCACATTGTACTGGGAAGG + Intergenic
1183082015 22:35462785-35462807 CTCACAACATCTTTGTGGGTCGG - Intergenic
952508316 3:34028226-34028248 CTGACTACATGGTAGTAGGTGGG - Intergenic
959157361 3:102682915-102682937 TTCAGGACAATTTAGTGGGTAGG - Intergenic
971623440 4:28886948-28886970 CTCAGGACAATTTGGTGGGTAGG + Intergenic
972901330 4:43687796-43687818 CTCAAGACATGGTGGTGGGTGGG - Intergenic
973823725 4:54684955-54684977 CTCAGGACAAGGTAGTAGGTTGG - Intronic
993864809 5:93179850-93179872 CTCACTACATTTTAGAGGGAAGG + Intergenic
1004678602 6:17869615-17869637 ATAATGGCATTGTAGTGGGTTGG - Intronic
1024027449 7:45424697-45424719 CTCACGACATTGAAGTGGAAGGG - Intergenic
1027719151 7:81716829-81716851 CTCACGGCTTTTTAGTGGGCTGG + Intronic
1029024831 7:97405084-97405106 CTTACGACATTGTACTTGGGAGG - Intergenic
1049398000 8:142410845-142410867 CTCACGACAGTGCTGTGTGTGGG + Intergenic
1051468949 9:17412440-17412462 CTCAAACCATTGTAGTGAGTTGG - Intronic
1194066105 X:89264476-89264498 CACCTGACATTCTAGTGGGTTGG - Intergenic
1197555326 X:127946167-127946189 CACCCCACATTCTAGTGGGTTGG + Intergenic
1199982693 X:152929466-152929488 CTCTCAACAGTGTGGTGGGTGGG + Intronic
1200720275 Y:6598596-6598618 CACCTGACATTCTAGTGGGTTGG - Intergenic