ID: 1138288618

View in Genome Browser
Species Human (GRCh38)
Location 16:55829015-55829037
Sequence GGCTGGACCCAGATTCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 2, 1: 0, 2: 2, 3: 19, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138288611_1138288618 22 Left 1138288611 16:55828970-55828992 CCCTGCTGGACATGGAGAATAAA 0: 1
1: 0
2: 3
3: 21
4: 214
Right 1138288618 16:55829015-55829037 GGCTGGACCCAGATTCCAGGTGG 0: 2
1: 0
2: 2
3: 19
4: 217
1138288612_1138288618 21 Left 1138288612 16:55828971-55828993 CCTGCTGGACATGGAGAATAAAT 0: 1
1: 0
2: 2
3: 15
4: 176
Right 1138288618 16:55829015-55829037 GGCTGGACCCAGATTCCAGGTGG 0: 2
1: 0
2: 2
3: 19
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138288618 Original CRISPR GGCTGGACCCAGATTCCAGG TGG Intronic
900107398 1:989691-989713 GGCTGGACCCCCCTTCCATGAGG + Intergenic
900798318 1:4722885-4722907 GGCTGGGGCAAGGTTCCAGGAGG + Intronic
900882695 1:5393346-5393368 TGCTGGACCCTGAGTCCAGCTGG + Intergenic
901221400 1:7585936-7585958 AGCTGGACCCAGGGTCCTGGGGG - Intronic
901656314 1:10771830-10771852 GGCTGGAAGCGGGTTCCAGGGGG - Intronic
902783665 1:18719727-18719749 GGTTGGAGCCACAGTCCAGGGGG - Intronic
903646242 1:24897886-24897908 GGCTGGGCCCAGGGTCCAGGAGG + Intergenic
904270135 1:29344430-29344452 GCATGGACCCAGTTTCCAGCAGG + Intergenic
904428399 1:30446414-30446436 GCATGGACCCAGTTTCCAGCAGG - Intergenic
904535303 1:31195480-31195502 AGCTGGATCCAGAGTGCAGGTGG - Intronic
904875514 1:33651800-33651822 GGCAGAAACCAGGTTCCAGGGGG + Intronic
906145969 1:43560875-43560897 GGCTGGACACTGAGGCCAGGTGG - Intronic
907233694 1:53025194-53025216 GCCGGGAGCAAGATTCCAGGAGG - Intronic
912529545 1:110310419-110310441 GGCTGGAACCAGATGCCAATAGG + Intergenic
914311952 1:146474623-146474645 GGTTGGATCCTGATTGCAGGAGG + Intergenic
914502395 1:148258710-148258732 GGTTGGATCCTGATTGCAGGAGG - Intergenic
914709357 1:150198487-150198509 TGATGTACCCAGATTCCATGAGG - Intergenic
915040939 1:152967731-152967753 CGCTGGATCCAGAATCCAGGAGG - Intergenic
915373691 1:155373505-155373527 GGCTGGTCTCAAATTCCTGGGGG + Intronic
921258773 1:213366701-213366723 CTCTAGACCCAGATGCCAGGTGG - Intergenic
924225404 1:241917725-241917747 GGCGGGGCCCTGGTTCCAGGAGG + Intergenic
1069633710 10:69912931-69912953 TTCTGGTCCAAGATTCCAGGTGG - Intronic
1070465535 10:76719463-76719485 GGCAGGAGCCAGATTACAAGGGG - Intergenic
1070677821 10:78424650-78424672 GGCTGAACCCAGGTGCTAGGTGG - Intergenic
1070767480 10:79065155-79065177 GCCTGGGCCCAGGTTTCAGGAGG - Intergenic
1070792230 10:79196368-79196390 GGCTGGGTCCAGGTCCCAGGGGG - Intronic
1070829827 10:79411525-79411547 GGATGGAACCAGATTCTAGAGGG + Intronic
1071248479 10:83791035-83791057 GGCTGACCTCAGATCCCAGGGGG + Intergenic
1073083498 10:100874063-100874085 GGCTGGGCCCAGCTTCGAGGGGG + Intergenic
1074382492 10:112992096-112992118 GGCAGGATGCAGACTCCAGGCGG + Intronic
1075987985 10:126804654-126804676 GCCTGGCCTCAGCTTCCAGGAGG - Intergenic
1077676088 11:4193976-4193998 GGGAGGAGCCAGCTTCCAGGAGG - Intergenic
1081623759 11:44634695-44634717 CGCTGGAGCCAGCATCCAGGAGG - Intergenic
1083965684 11:66042474-66042496 GGCAGGACCCATACTCCTGGAGG + Exonic
1084544910 11:69810402-69810424 GGCTGGACCCCCTTACCAGGGGG + Exonic
1085470752 11:76756374-76756396 GGCAGGACCAAGTTTCCATGCGG - Intergenic
1086435150 11:86772897-86772919 GGCTGCAGCCAGATTGCAGTAGG - Intergenic
1088845592 11:113663391-113663413 GGGTGGACCCTGGTTCCAGGAGG + Intergenic
1089061480 11:115629573-115629595 GGCTGGACTCAGCTTCCACAAGG - Intergenic
1089693121 11:120199003-120199025 TGCTGGAGACAGGTTCCAGGGGG + Intergenic
1089925047 11:122248437-122248459 GGCAGAAGCCAGATTCCATGTGG + Intergenic
1090137253 11:124210588-124210610 GGCTGGGCCGAGTTTCCTGGTGG - Intergenic
1090506924 11:127325315-127325337 ACCTGGACCAAGTTTCCAGGAGG + Intergenic
1092073192 12:5650082-5650104 GACTGAACCAAGACTCCAGGGGG - Intronic
1092151879 12:6254625-6254647 GGCTGGACCCAGAGTGTTGGAGG + Intergenic
1093629572 12:21392364-21392386 GGCTGGATCCACCTGCCAGGAGG - Intronic
1098029124 12:66236247-66236269 GCCTGAACCCAGATTTCTGGTGG - Intronic
1098917678 12:76274271-76274293 GGCTGGGCCCCTGTTCCAGGAGG + Intergenic
1099854066 12:88141993-88142015 GGCTGGACCCAGAGTCCGCGTGG - Exonic
1102195339 12:111021389-111021411 TGCTGGGTCCAGCTTCCAGGGGG + Intergenic
1103749343 12:123149032-123149054 GACAGGACCCAGATCCCAGGGGG + Intronic
1104859204 12:131916009-131916031 GGCTGAACACAGCTCCCAGGGGG - Exonic
1109960185 13:69619244-69619266 GGCTGAACACTGTTTCCAGGAGG + Intergenic
1113741410 13:112714554-112714576 GGCTGGAGCCAGAAGCCAGACGG - Intronic
1113858710 13:113466728-113466750 GGCTGGAAGCTGAATCCAGGTGG + Intronic
1113947257 13:114051224-114051246 GCCTGAACCCAGACCCCAGGTGG - Intronic
1113947825 13:114054446-114054468 GGAGGGGCCCAGAGTCCAGGTGG + Intronic
1113947834 13:114054468-114054490 GGAGGGGCCCAGAGTCCAGGTGG + Intronic
1117102138 14:52360832-52360854 GGCTGGAGCCAGCTTCCAGATGG + Intergenic
1118877500 14:69797522-69797544 GGCTGGACCTAGATTCAGGTGGG - Intergenic
1119434140 14:74586927-74586949 GGCTGGACCCACAGCCCAGGAGG - Intronic
1119574879 14:75711210-75711232 AGCTGCACCCAAATACCAGGGGG - Intronic
1119856405 14:77904461-77904483 TGCTGGACTCAGGCTCCAGGAGG + Intronic
1120203452 14:81563002-81563024 GGCTGGAAGCACATTCCAGCAGG - Intergenic
1121740998 14:96252319-96252341 GGCTGGTCTCAAATTCCTGGGGG - Intronic
1122243187 14:100382620-100382642 GGCTGGAGACAGGTCCCAGGTGG - Intronic
1127215646 15:56820722-56820744 GCGTTGACTCAGATTCCAGGTGG - Intronic
1127933144 15:63610929-63610951 GGCTGTACCCAGTGTTCAGGAGG + Intronic
1129038515 15:72665306-72665328 TGCTGGAGCCAGTTCCCAGGAGG + Intronic
1129211374 15:74071924-74071946 TGCTGGAGCCAGTTCCCAGGAGG - Intronic
1129399027 15:75269160-75269182 CGCTGGAGCCAGTTCCCAGGAGG + Intronic
1129402635 15:75293436-75293458 CGCTGGAGCCAGTTCCCAGGAGG + Intronic
1129476167 15:75785861-75785883 TGCTGGAGCCAGTTCCCAGGAGG + Intergenic
1129728504 15:77916200-77916222 CGCTGGAGCCAGTTCCCAGGAGG - Intergenic
1131150203 15:90043003-90043025 GGCTGGGCCCTCACTCCAGGAGG - Intronic
1133344133 16:5058916-5058938 TGTTGGGCCCAGATTCCAAGTGG - Intronic
1135158499 16:20073792-20073814 GGCTGAGCCAAGACTCCAGGCGG - Exonic
1137566073 16:49533218-49533240 GGCTGGACAGAGAGGCCAGGTGG + Intronic
1137666630 16:50253591-50253613 GGCTGGACCCAGGTTTGTGGTGG + Intronic
1138279880 16:55764634-55764656 GGCTGGACCCAGATTCCAGGTGG - Intergenic
1138288618 16:55829015-55829037 GGCTGGACCCAGATTCCAGGTGG + Intronic
1138527917 16:57619681-57619703 GTCTGGCCCAGGATTCCAGGCGG + Intronic
1141656869 16:85421277-85421299 CCCTGGCCCCAGATTGCAGGGGG + Intergenic
1143366921 17:6414537-6414559 GGCGGGACCCTGGTTCCAGAAGG - Intronic
1146424427 17:32723115-32723137 TGGTGCACCCTGATTCCAGGGGG + Intronic
1148150992 17:45396383-45396405 GGATGGACGCAGGGTCCAGGGGG - Intronic
1148324284 17:46774110-46774132 GGCTGCATCCAGCTTGCAGGGGG + Intronic
1151885711 17:76922278-76922300 TACTAGACCCAGATTCCATGTGG + Intronic
1152422499 17:80201690-80201712 GGCTGGATTCAGAGTCCCGGGGG + Intronic
1153376405 18:4385386-4385408 GTTTTGACCCAGATTTCAGGGGG - Intronic
1153802058 18:8680013-8680035 GTCTAAACCCAGATTGCAGGAGG - Intergenic
1154199453 18:12289099-12289121 TTCAGGTCCCAGATTCCAGGTGG - Intergenic
1156482783 18:37446534-37446556 GGCTGGGACCATCTTCCAGGTGG - Intronic
1157750413 18:50173354-50173376 AGCAGGGCCCAGATTACAGGAGG + Intronic
1160720439 19:594785-594807 GCATGGACCCATATCCCAGGTGG + Intronic
1161628047 19:5338418-5338440 GGCAGGACCCTGCTTCCCGGAGG + Intronic
1161771114 19:6231208-6231230 GTCACGACCCAGTTTCCAGGAGG + Intronic
1162017880 19:7855557-7855579 CGCTGGACCCAGACTCAAAGAGG + Intronic
1162078722 19:8206139-8206161 GGCTGGAGAGAGATTTCAGGTGG - Intronic
1162571918 19:11479308-11479330 GGCGGGTCCCAGGGTCCAGGAGG + Intronic
1162860753 19:13504756-13504778 AGCATGACCCAGATTCCAGGAGG - Intronic
1165330348 19:35138501-35138523 GGCTGGACCCAGTTCCCAGGGGG + Intronic
1165889251 19:39100735-39100757 GGCGGGACCCAGATCCCAGCTGG - Exonic
1165934476 19:39380868-39380890 GTCTGGACCCAGCTTAGAGGTGG + Intronic
1166278665 19:41774613-41774635 GTCTGGCCCCAGCTCCCAGGTGG - Intergenic
1166329435 19:42069762-42069784 GGCAGGGCCCAGGCTCCAGGGGG - Intronic
1167072229 19:47227931-47227953 GACTGCAGTCAGATTCCAGGAGG + Intronic
1167428732 19:49442676-49442698 GGGTGGGGACAGATTCCAGGGGG - Intergenic
1168242635 19:55095181-55095203 GGCAGGAACCAGACCCCAGGGGG + Intronic
1168670007 19:58233844-58233866 GGCTGGACACAATTTCCAAGTGG - Intronic
925746287 2:7046399-7046421 GGCTGGAGCCACATCGCAGGAGG + Intronic
925920485 2:8634507-8634529 TGCCGGAGCCAGATGCCAGGAGG - Intergenic
926688875 2:15718993-15719015 GGCTGGAGCCAAATTCCTTGGGG + Intronic
928030198 2:27771634-27771656 GACTGGAGGCAGGTTCCAGGCGG + Intergenic
929783931 2:44975709-44975731 AGCTGGATCCAGAATCCCGGAGG - Intergenic
929997133 2:46835729-46835751 CGCTGGACCCACATCCAAGGAGG + Intronic
931174954 2:59845135-59845157 GGGTGGACCCAGAGTTCAGGAGG - Intergenic
933318477 2:80743020-80743042 GATTGGCCCCAGATTACAGGAGG - Intergenic
933360987 2:81283706-81283728 GGCTGGACACTGATTTCAGAAGG + Intergenic
936960331 2:118066683-118066705 AGCTGGACCGGGATTCCAAGTGG + Intergenic
944085937 2:195848185-195848207 GGCTGGACCAACATTCCTTGAGG + Intronic
948992225 2:241560985-241561007 GGCTGGCCCCAGACTGAAGGTGG - Intronic
1169154103 20:3314605-3314627 GGCTGGACCCAGATCTCTTGAGG - Intronic
1171432005 20:25088892-25088914 GACAGGACACAGATTCAAGGTGG + Intergenic
1171837263 20:30168479-30168501 GGCTGGACCCGGGGTCCAGTTGG + Intergenic
1173295030 20:41748491-41748513 GGCTCTGCCCAGACTCCAGGTGG + Intergenic
1174012858 20:47464565-47464587 GGCTGTACCCAGATGCAAAGGGG - Intergenic
1174173781 20:48632526-48632548 GGCTGGCCCCACCCTCCAGGCGG + Exonic
1174394027 20:50234830-50234852 GGCGGGACCCAGAGCCCATGGGG + Intergenic
1174849665 20:53980306-53980328 GGCTGAGGCCAGATTCCAGAGGG + Intronic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1175510968 20:59525993-59526015 GGCTGGACCCAGGCGACAGGAGG - Intergenic
1176091522 20:63320537-63320559 GGCTGGACAGAGAGTCCTGGAGG + Intronic
1178324101 21:31629467-31629489 GGCAACACCCACATTCCAGGTGG + Intergenic
1179622353 21:42625605-42625627 AGCTGGACCCACATTGCAGGAGG + Intergenic
1180785451 22:18544605-18544627 GACTGGAACAAGATTCCAGAAGG + Intergenic
1180951218 22:19721456-19721478 GGCTGGAGCCAGAGCCCATGTGG - Intronic
1181022427 22:20110511-20110533 GGCTGGCCCGTGATGCCAGGTGG + Exonic
1181242354 22:21483958-21483980 GACTGGAACAAGATTCCAGAAGG + Intergenic
1181750011 22:24982748-24982770 GGCTGGGCACAGATCCCAGAGGG + Intronic
1181938214 22:26454060-26454082 GGCAGGATCCAGAAACCAGGGGG - Intronic
1182359913 22:29740364-29740386 GGCTGGCCACAGGGTCCAGGTGG + Intronic
1182547373 22:31084064-31084086 GCATGGACCCAGATCTCAGGTGG + Intronic
1182618964 22:31607877-31607899 GGGTGGACCCGGAAGCCAGGAGG + Intronic
1183267797 22:36840054-36840076 TGCTGTGGCCAGATTCCAGGAGG + Intergenic
1183615017 22:38938743-38938765 GACAGGAGCCAGATTGCAGGGGG + Intergenic
1183653682 22:39173172-39173194 GGCTGGAACCAGATCACAGAGGG - Intergenic
1183658651 22:39205745-39205767 TGCTGGACCCAGGTTCCAGCTGG + Intergenic
1185015369 22:48339624-48339646 GGCAGGGCCCAGCTTCCTGGAGG - Intergenic
1185287746 22:50010202-50010224 GGCTGGACCCAGCGTCCTGATGG + Intronic
1185315042 22:50175298-50175320 CCCTGGACCCAGACTCCAGTAGG - Intronic
949370481 3:3329230-3329252 GGCTTCACCCAGATACCAAGGGG - Intergenic
949704294 3:6798162-6798184 GGCTGCAGCCAGATTGCAGTGGG + Intronic
950528503 3:13539011-13539033 GGCTGGTGCAAGAGTCCAGGTGG - Intergenic
952241400 3:31533588-31533610 GGCTGCACCCACACTCCCGGCGG - Intronic
952888272 3:38024904-38024926 GGGTGGATCCAGAACCCAGGAGG + Intronic
952904900 3:38133304-38133326 GTCTGGAGCCAGATTGTAGGGGG + Intronic
953000832 3:38931582-38931604 GGCATTGCCCAGATTCCAGGAGG + Intronic
953534224 3:43765162-43765184 GGCTGCAGCCAGATTCCAGCTGG + Intergenic
955811537 3:62795882-62795904 GACTGGGACCATATTCCAGGTGG + Intronic
960157190 3:114307982-114308004 GCCTGGACACAGCTTCCTGGGGG - Exonic
961809863 3:129515413-129515435 GCCTGAAGCCAGAGTCCAGGGGG + Intronic
966313701 3:178622770-178622792 TGCTGTACTCAGATTTCAGGTGG - Intronic
967293866 3:187947143-187947165 GGCTGTGCCCAGATGCCAGCTGG + Intergenic
969057313 4:4409945-4409967 GGCTGGGCCCACTTTCGAGGAGG - Intronic
969272314 4:6111154-6111176 GGCCAGATCCAGCTTCCAGGTGG - Intronic
969568352 4:7993215-7993237 GGCTTGGCCCAGGTGCCAGGTGG - Intronic
969706105 4:8792926-8792948 GCCTGGCCCCAGACTCCAGCAGG - Intergenic
970310370 4:14776627-14776649 GGCTGGTCCCAGAAGCCAAGTGG + Intergenic
972354506 4:38267706-38267728 GGCTGGACACAGAAGCCAGAGGG + Intergenic
977453221 4:97225164-97225186 AGCTGAGCCCAGTTTCCAGGAGG + Intronic
981066531 4:140492006-140492028 GGGTGAACTCAGATTCAAGGAGG - Intronic
983881770 4:172940883-172940905 GGCTGGTCTCAAACTCCAGGAGG + Intronic
985630669 5:1012421-1012443 GGCAGGTCCCAGCTTACAGGAGG + Intronic
987311384 5:16684451-16684473 GGCTGGTCTCAAATTCCTGGCGG + Intronic
992324913 5:75651150-75651172 GGGTCGACCCAGATTCAAGGAGG + Intronic
992747629 5:79835163-79835185 GCCAGGATCCAGAGTCCAGGGGG + Intergenic
993838823 5:92850254-92850276 GGCTGCACACAAATTTCAGGTGG + Intergenic
994997004 5:107076828-107076850 GGCTGGTGCCAGATTGCAGATGG - Intergenic
996001421 5:118368897-118368919 GCAAGGACCCAGATGCCAGGTGG - Intergenic
996792225 5:127305344-127305366 GGATGCACCCAGATTTGAGGGGG + Intronic
997662787 5:135602369-135602391 GGATGGACCTGGCTTCCAGGAGG + Intergenic
1001241709 5:170076240-170076262 TGCTGGACCAAGTTTCCAGGAGG - Intronic
1002064813 5:176646828-176646850 GGCTTGAGCCAGGTTCCGGGGGG + Intergenic
1002133820 5:177096474-177096496 GAGTGGGCCCAGACTCCAGGAGG + Intronic
1005798221 6:29390939-29390961 GGCTGACCTCAGATCCCAGGAGG + Intronic
1006384015 6:33718866-33718888 GGCCCCACCCAGATGCCAGGGGG - Intergenic
1007054197 6:38865744-38865766 TGCTGTACCCAGCTTGCAGGTGG + Intronic
1007605431 6:43114507-43114529 GGCTGTGCCCCCATTCCAGGGGG - Intronic
1007844140 6:44739959-44739981 GTCAGGACCCTGACTCCAGGTGG - Intergenic
1008459047 6:51746469-51746491 GGCTGAGTCCAGATTCAAGGGGG + Intronic
1010037232 6:71340377-71340399 GGCTGGACCCTGGTTCCAGGAGG - Intergenic
1014048992 6:116929561-116929583 GGTTGGAAGAAGATTCCAGGAGG - Intronic
1014449333 6:121565349-121565371 GGCTGGGCCCAGAGTCCCTGTGG + Intergenic
1015750173 6:136550745-136550767 CGCTCGTCCCAGACTCCAGGAGG - Intronic
1018518706 6:164618044-164618066 GGTTGGTCTCAGCTTCCAGGAGG - Intergenic
1018710383 6:166494557-166494579 GGCTGGAGCCAGTTTCTAGAAGG - Intronic
1020098388 7:5380923-5380945 AGCTTGTCCCAGACTCCAGGAGG - Intronic
1020105120 7:5419295-5419317 GGCCGGAGCCAGATCGCAGGCGG + Intronic
1023910235 7:44549641-44549663 GGCTGGTCCCAAACTCCTGGAGG + Intergenic
1027815333 7:82961451-82961473 TGCTGGAGCCAGATTCCAGAAGG + Intronic
1030115458 7:106059199-106059221 TGCTGTCCCCAGATGCCAGGAGG - Intergenic
1031070623 7:117157371-117157393 TCATGGACTCAGATTCCAGGAGG + Intronic
1032441312 7:131945025-131945047 AAATGGAACCAGATTCCAGGAGG + Intergenic
1034951427 7:155298992-155299014 GGCTGTACCCGGACGCCAGGAGG - Intronic
1035369918 7:158372943-158372965 AGGTGGCCCCAGATTGCAGGAGG - Intronic
1040095195 8:43435871-43435893 GGCTGGCTCCAGTGTCCAGGAGG - Intergenic
1042782004 8:72501807-72501829 GGCTTGACAGAGATTCCATGTGG + Intergenic
1043383052 8:79723296-79723318 GGCTGGGCCCAGGCTGCAGGTGG + Intergenic
1046653494 8:116867275-116867297 GGCTGGCCCCATTTTACAGGTGG + Intronic
1047441114 8:124879503-124879525 GGCTGGGCCCAGATCACAGAGGG + Intergenic
1047526967 8:125641797-125641819 GCCTTGGCCCAGATTCCTGGGGG + Intergenic
1049299806 8:141863488-141863510 GGGAGCACCCAGACTCCAGGGGG + Intergenic
1049819877 8:144627060-144627082 AGCTGGATCCAGGTGCCAGGTGG - Intergenic
1049822866 8:144646757-144646779 CGCTGGGCCCAGAGTCCAAGCGG + Intergenic
1052832712 9:33228996-33229018 AGCTGGGCCCAGATGCAAGGAGG + Intronic
1053202691 9:36163533-36163555 GGCTTGTCGCACATTCCAGGAGG - Exonic
1056217251 9:84416699-84416721 GGCTGGACCCAGGCTTCAGATGG + Intergenic
1058703583 9:107620792-107620814 GGGTGGACCCAAAAGCCAGGGGG - Intergenic
1059392067 9:114005624-114005646 GTCTGGAACCAGACCCCAGGTGG + Intronic
1060766861 9:126300696-126300718 GGCTGGACCCACATTTCAAAGGG - Intergenic
1060941643 9:127546036-127546058 AGCAGGACCCACACTCCAGGGGG + Intronic
1060972828 9:127748589-127748611 GGCAGGACCCACCTCCCAGGAGG + Intronic
1061589273 9:131588333-131588355 GGCTGGAGCCCACTTCCAGGTGG + Intronic
1061847346 9:133395122-133395144 GGCTGGACCCAGGTTCCCCATGG + Intronic
1062049986 9:134442311-134442333 GGCTGTGCCCAGAGTCCAGGGGG - Intergenic
1062446894 9:136598935-136598957 GGCTGGGCCCAGATTGCCAGTGG - Intergenic
1062482882 9:136760577-136760599 GGCTGTGCCCAGATTCTTGGCGG + Intronic
1062622162 9:137428021-137428043 GGCTGCCCACAGGTTCCAGGAGG + Exonic
1186169074 X:6858226-6858248 GGATGTACCCTGATTCCATGGGG + Intergenic
1186723831 X:12335550-12335572 GGCTAGACGCAGAGTCCAAGGGG - Intronic
1187835719 X:23430214-23430236 GCCTGACCTCAGATTCCAGGAGG + Intergenic
1189265647 X:39714279-39714301 GGTTGGAGGCAGAATCCAGGTGG - Intergenic
1191184075 X:57592007-57592029 GGCTGGAACCAGAGCCGAGGAGG - Exonic
1191213315 X:57910440-57910462 GGCTGGAACCAGAGCCGAGGAGG + Exonic
1192239042 X:69314990-69315012 AGCTGGCCCCAGATTCCACCAGG - Intergenic
1192245083 X:69365369-69365391 GGCTGAGCCCAGTGTCCAGGAGG - Intergenic
1199896519 X:152132140-152132162 GGCTGGAACCAGACTCCTGGTGG - Intergenic
1200078449 X:153563736-153563758 GGCTGGTGCCACATTCCTGGGGG - Intronic
1201311963 Y:12605441-12605463 AGCTGCACCCAGTGTCCAGGAGG + Intergenic