ID: 1138289283

View in Genome Browser
Species Human (GRCh38)
Location 16:55833058-55833080
Sequence TGGAAGGGCGACAGTTCTCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138289276_1138289283 4 Left 1138289276 16:55833031-55833053 CCAGGATAAAGGCACGGAGCCAC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1138289283 16:55833058-55833080 TGGAAGGGCGACAGTTCTCGGGG 0: 1
1: 0
2: 1
3: 2
4: 49
1138289270_1138289283 30 Left 1138289270 16:55833005-55833027 CCAAGCCGCGGAAGCAGAGAGAG 0: 1
1: 1
2: 0
3: 22
4: 378
Right 1138289283 16:55833058-55833080 TGGAAGGGCGACAGTTCTCGGGG 0: 1
1: 0
2: 1
3: 2
4: 49
1138289272_1138289283 25 Left 1138289272 16:55833010-55833032 CCGCGGAAGCAGAGAGAGTGGCC 0: 1
1: 1
2: 2
3: 20
4: 207
Right 1138289283 16:55833058-55833080 TGGAAGGGCGACAGTTCTCGGGG 0: 1
1: 0
2: 1
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138289283 Original CRISPR TGGAAGGGCGACAGTTCTCG GGG Exonic
904549790 1:31306204-31306226 TGAAAGGGTGAAAGTTCTCAAGG - Intronic
906057831 1:42930135-42930157 GGGAAGGGCCCCAGTTCTAGAGG + Intronic
909455393 1:75843710-75843732 TAGAAAGGGGACAGTTCTAGAGG + Intronic
909564437 1:77039189-77039211 TGGAAGAGTGACTGTTCTCCAGG - Intronic
916267038 1:162900909-162900931 TGGCAGGGCTACAGTTCTTCTGG + Intergenic
921606617 1:217163519-217163541 TTGAAGGGAGACATTTCTAGGGG + Intergenic
922356360 1:224780064-224780086 TGGAAGGGCGACGCAACTCGAGG - Intergenic
1064048685 10:12042429-12042451 TGGAGGGGCGAAAGTGTTCGGGG - Intronic
1075551961 10:123399632-123399654 AGGAAGGGCGAAGGGTCTCGGGG - Intergenic
1075679622 10:124322977-124322999 TGGAGGTGGGAGAGTTCTCGTGG - Intergenic
1083148563 11:60775952-60775974 TGGAAGGGTGACAGGGCTCAGGG - Exonic
1087836680 11:102882027-102882049 TGCAAGGGAGATAGTTCTTGAGG + Intergenic
1091433245 12:453833-453855 TGGAAGGGCTGGCGTTCTCGCGG + Intergenic
1095882591 12:47154045-47154067 TTGATGGGAGACAGTTCTCCAGG + Intronic
1096614989 12:52827141-52827163 TGGAAGGGCTAGACTTCTAGAGG - Intronic
1102203558 12:111074937-111074959 AGCAAGGGAGACAGTTCTGGGGG - Intronic
1104292076 12:127479479-127479501 TGAAAGTGCGTCAGTTCCCGGGG + Intergenic
1112557013 13:100478303-100478325 AGGAAGGGAGACAGTTGTCAGGG - Intronic
1117323200 14:54643863-54643885 TGGAAAGGCGTCTGTTCTCCAGG - Intronic
1118323687 14:64767834-64767856 TGGAGGTGTGCCAGTTCTCGAGG - Exonic
1138279246 16:55760617-55760639 TGGAAGGGCGACAGTTCCGGGGG - Intergenic
1138289283 16:55833058-55833080 TGGAAGGGCGACAGTTCTCGGGG + Exonic
1138698639 16:58839797-58839819 AGGAAGGGCCACAGGTCTGGAGG + Intergenic
1147742847 17:42678495-42678517 TTCACGTGCGACAGTTCTCGCGG - Intergenic
1152763053 17:82119574-82119596 TGGATGGGGGACAGGTCTCTTGG + Intronic
1153195468 18:2591157-2591179 TGCAAGTACTACAGTTCTCGGGG + Intronic
1159676247 18:71287408-71287430 TGGAAGGACGCCAGTTCTGTTGG + Intergenic
1162890323 19:13728151-13728173 TGCAACGGGGACAGTGCTCGAGG - Intergenic
1163773957 19:19207042-19207064 TGGGAGGGCTACAGATCTCGGGG + Intergenic
1164181256 19:22820797-22820819 TGTAAGGGTGACAGTTCTAATGG - Intergenic
1168171898 19:54594995-54595017 AGGAAGGGAGTCAGTTCTCAGGG + Intronic
931067081 2:58599154-58599176 GGGAAGGGAGTCAGTTCTCTGGG - Intergenic
934112220 2:88754634-88754656 TGGAAGTGTGACAGTTCACGTGG + Intergenic
947469093 2:230383639-230383661 TGGAAGGCCTGCAGTTCACGAGG + Intronic
947527174 2:230885852-230885874 AGGATGGGTGACAGTCCTCGAGG - Intergenic
1170456259 20:16536713-16536735 TGGAAGTTTGACAGTTCTCCAGG - Intronic
1170687435 20:18582078-18582100 TGCAGGGGAGACAGTTCTCCAGG - Intronic
951191848 3:19781074-19781096 TGGGAGGACAACAGTTCTCTAGG - Intergenic
954418235 3:50404618-50404640 TGGGAGGGTGACAGTTCCCATGG + Intronic
978888171 4:113790860-113790882 TGAAAAGGAGACAGTTCTCAGGG + Intergenic
980798054 4:137711156-137711178 TGGATGGGTGCCACTTCTCGTGG + Intergenic
981247503 4:142557165-142557187 AGGAAGGCCGGCAGTTCTCCAGG + Intronic
990369549 5:55103530-55103552 TGAAAGGGTGACAGCTCTTGGGG + Intronic
1001860289 5:175048238-175048260 TGGAAGGGACACAGTTCTACAGG - Intergenic
1016939720 6:149474163-149474185 AGGAAGAGGGACAGTTCTCAGGG + Intronic
1022178667 7:27897200-27897222 AGGAAGGCCGATTGTTCTCGAGG + Intronic
1029132108 7:98339532-98339554 TGGAGGGTAGACAGTTCTGGTGG - Intronic
1030720633 7:112866539-112866561 AGGAAGGGCGTGAGTTCTAGTGG + Intronic
1040498761 8:47989528-47989550 GGAGAGGGCGACAGTTGTCGGGG + Intergenic
1043717437 8:83505186-83505208 TGGATGGGCGATATTTCTCAGGG + Intergenic
1044728856 8:95214356-95214378 TGGCAGGGCCACTGTTCTCAAGG + Intergenic
1192320931 X:70090033-70090055 TGGCAGGACGACAGTTCCTGTGG - Intergenic
1195695822 X:107666544-107666566 TGGAAGGAAGACAGTTATGGTGG - Intergenic