ID: 1138292900

View in Genome Browser
Species Human (GRCh38)
Location 16:55863136-55863158
Sequence ACTTGTGCACACCAGTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138292898_1138292900 -2 Left 1138292898 16:55863115-55863137 CCATAACGCACATACACACACAC 0: 1
1: 4
2: 223
3: 2678
4: 8621
Right 1138292900 16:55863136-55863158 ACTTGTGCACACCAGTGGTGTGG 0: 1
1: 1
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138292900 Original CRISPR ACTTGTGCACACCAGTGGTG TGG Intronic
901138634 1:7013697-7013719 GCTTGTCCACACCAGGGGGGCGG - Intronic
902316206 1:15620613-15620635 AAGTTTGGACACCAGTGGTGTGG - Intronic
902576036 1:17378247-17378269 ATATGTGTACACCAGGGGTGGGG - Intronic
903164613 1:21511388-21511410 AATAGTGCCTACCAGTGGTGAGG + Intronic
906521400 1:46469059-46469081 ACTTGTGCACCCCTGGGATGGGG - Intergenic
907698985 1:56765095-56765117 ACTTCTGCCCAGCAGTGATGAGG - Intronic
912815785 1:112826916-112826938 ACTTGTGCACTCCATTTGAGTGG + Intergenic
915683481 1:157606133-157606155 AATTGTGCACACCAGTGCCTTGG + Intergenic
917255271 1:173109268-173109290 ACCTCTGCAGCCCAGTGGTGTGG - Intergenic
919935697 1:202249142-202249164 ACTGATGGACACCACTGGTGTGG - Intronic
922037549 1:221863862-221863884 ACAGGTTCACACCAGTGCTGAGG + Intergenic
1067777586 10:49174690-49174712 AGGTGTGCAAAGCAGTGGTGGGG + Intronic
1068250773 10:54436911-54436933 TCTAGTGCAAACCAGAGGTGAGG - Intronic
1068760735 10:60706100-60706122 AGTGGTGCACACCAGTGCGGTGG - Intronic
1073737410 10:106365386-106365408 ACTTCTGCACAGTGGTGGTGAGG + Intergenic
1075897908 10:126013889-126013911 ACTAGTGCTGACCAGAGGTGGGG - Exonic
1076285571 10:129292848-129292870 GCCTTTGCACACCATTGGTGGGG + Intergenic
1078478858 11:11658734-11658756 ACATGTGCACACTATTGGAGTGG - Intergenic
1079304660 11:19311639-19311661 TATTGTCCACACAAGTGGTGTGG + Intergenic
1083184780 11:61011205-61011227 TCCTGTGCACACCTGTGTTGGGG + Intronic
1084031488 11:66483634-66483656 ACTTGTGCACACATGTGAGGAGG + Intronic
1088705303 11:112457051-112457073 ACTTGTGCATAACATTGGTGGGG - Intergenic
1091814809 12:3429666-3429688 ACTTGTGCACTCCATTTGAGTGG - Intronic
1092108234 12:5939475-5939497 ACTTCTGCATACCACAGGTGGGG - Intronic
1095327689 12:40917037-40917059 AATTCTTCATACCAGTGGTGGGG + Intronic
1095929133 12:47608129-47608151 AAATGAGAACACCAGTGGTGTGG - Intergenic
1097328787 12:58310395-58310417 TCTTTTGGACACCGGTGGTGCGG + Intergenic
1110265456 13:73532174-73532196 AATGGTGCACACCAGAAGTGAGG - Intergenic
1117988758 14:61413833-61413855 ACTTGAGCAGAATAGTGGTGAGG - Intronic
1119569734 14:75660115-75660137 ACTTGTGCAGAAAAGTGGAGAGG - Intronic
1119587709 14:75852208-75852230 TCCTGTGCAGACCCGTGGTGTGG + Intronic
1125542064 15:40475337-40475359 ACAAGTGGACACCTGTGGTGTGG + Intergenic
1130371464 15:83288450-83288472 ACTTGAGCCCACCAGTGGCCTGG + Intergenic
1132324693 15:100959018-100959040 ACTTCAGCACAACAGTGGTAGGG - Intronic
1137709497 16:50556362-50556384 CCTTGTGGGCACCAGTCGTGGGG + Intronic
1138292900 16:55863136-55863158 ACTTGTGCACACCAGTGGTGTGG + Intronic
1140919341 16:79522435-79522457 ACTTGTGCACACAAGTGGTGAGG - Intergenic
1143623380 17:8094006-8094028 CCTTGTGGCCACCAGGGGTGAGG - Intergenic
1148130981 17:45262473-45262495 ACTTGTGCACACAGGGAGTGTGG + Intergenic
1151555366 17:74843792-74843814 ACCTGGGCACACCTGTGGGGGGG + Intronic
1152749915 17:82057904-82057926 ACTTTTGCACACGCGTGCTGAGG + Exonic
1154330195 18:13423058-13423080 GCTTCTGGACACCAGTGGTGTGG - Intronic
1165635706 19:37337949-37337971 AATTCTGGACTCCAGTGGTGGGG + Intronic
931879403 2:66552153-66552175 ACATGATCACACCAGTGTTGCGG + Intronic
933701501 2:85258383-85258405 AGGTGTGCACACCAGTGGCTTGG - Intronic
935181273 2:100693096-100693118 ACATGGGGACAGCAGTGGTGGGG - Intergenic
935978908 2:108607316-108607338 AATTGAGCACACCAGTTGTCTGG + Intronic
936610596 2:113998377-113998399 AAGTGTTCACCCCAGTGGTGAGG + Intergenic
940052188 2:149476798-149476820 CCAGGTGCACACCAGTGGGGAGG - Intergenic
940138628 2:150467755-150467777 CCTTGTTCACAGCAGTTGTGGGG - Intergenic
940889440 2:159020835-159020857 TCTTGGACACACCTGTGGTGTGG + Intronic
1171753649 20:29080091-29080113 ATTTGTGCATCCCAGAGGTGGGG - Intergenic
1179320172 21:40283922-40283944 CATTGTGCAAACCATTGGTGAGG - Intronic
1184914031 22:47555051-47555073 ACTTCTGAAGACCAGGGGTGAGG - Intergenic
1185105643 22:48868095-48868117 CCTGGTGCACGCGAGTGGTGGGG - Intergenic
949734453 3:7155383-7155405 ACTTGTGTATTCCAGGGGTGGGG - Intronic
952120412 3:30236425-30236447 GCTTTTGCACTGCAGTGGTGGGG + Intergenic
952701926 3:36337377-36337399 ACTTCTGCAAACCTGTGTTGTGG + Intergenic
954894483 3:53964046-53964068 AGTTGTACAGCCCAGTGGTGAGG - Intergenic
955349773 3:58184786-58184808 ACTTGTTCTCACCAGTGGAATGG - Intergenic
955676892 3:61458291-61458313 ACTTATGCACACCAAAGTTGGGG - Intergenic
961723133 3:128909078-128909100 AGTTGTGCACCCCAGTCTTGCGG + Exonic
963893730 3:150663555-150663577 ACTTGAGCCCACCATTGGCGGGG - Intronic
965293848 3:166917733-166917755 ACTTGGGCACAGAAGGGGTGAGG - Intergenic
974211768 4:58786755-58786777 ACTTGTGTACACAAGTTCTGAGG + Intergenic
976745267 4:88396866-88396888 ATATGTGCACACCACTGGTCAGG + Exonic
978459116 4:108930476-108930498 TGTGGTGCACACCAGTGGTATGG - Intronic
979916201 4:126437194-126437216 ACCTTTGCACACTATTGGTGGGG - Intergenic
980091772 4:128450373-128450395 AACTGTTCACACCAGTGATGTGG - Intergenic
984334284 4:178368938-178368960 ACATGTGTGCACCAATGGTGGGG - Intergenic
991943075 5:71873542-71873564 ACTTGTGCAGACCTGTGCTCTGG + Intergenic
993458327 5:88151260-88151282 ACTTGAGCACAATAGTGGAGAGG - Intergenic
996507550 5:124285336-124285358 ACTTGTTCAGACCTGAGGTGAGG - Intergenic
1000913260 5:167047767-167047789 AATTGTGAAAACCAGTTGTGTGG + Intergenic
1000938895 5:167336421-167336443 TCTTGTCCACAGGAGTGGTGGGG + Intronic
1001704797 5:173734054-173734076 ACTTGTTCACAGCAGAGCTGTGG - Intergenic
1002501160 5:179648576-179648598 AGCTGTACACACAAGTGGTGGGG - Intergenic
1003639665 6:7865987-7866009 ACTAGTGCACAGCAGTGGAGAGG + Intronic
1005443694 6:25898786-25898808 ACTGGTCCACACCAGTCATGTGG - Intergenic
1007262728 6:40575181-40575203 ACTAGTGCACAGCAGTGAGGAGG - Intronic
1010396709 6:75401127-75401149 ACTTGTGGACACCAGTAGTCTGG + Intronic
1011867979 6:91854968-91854990 AGTTGTTCACCTCAGTGGTGAGG + Intergenic
1012293264 6:97485530-97485552 AATTGTTCAGACCAGTGTTGTGG + Intergenic
1019075623 6:169385589-169385611 ACATGTGCACACCATGTGTGTGG - Intergenic
1020987607 7:15156101-15156123 ACATATGCACACCAGTAGAGTGG + Intergenic
1021468538 7:20973741-20973763 ACATGTGCATACTAGTTGTGAGG - Intergenic
1024447108 7:49493729-49493751 AGGTGTGCACACCAGGGGTCAGG - Intergenic
1033826074 7:145190789-145190811 AATCTTGCACACCATTGGTGGGG + Intergenic
1041262978 8:56037784-56037806 ATGTGTGCACACCTGTAGTGAGG - Intergenic
1045038778 8:98200732-98200754 ACTTTTGTACACCATTGGTGGGG - Intronic
1046285812 8:112092053-112092075 ACTTGTGGGCAGCAGGGGTGGGG + Intergenic
1049751062 8:144284348-144284370 ACATGTGCACACCATTCTTGGGG - Intronic
1050162559 9:2733538-2733560 CCTTGTGCATACCACTGGTTGGG - Intronic
1051357682 9:16254767-16254789 TCTTGTCCACCCCAGTAGTGAGG + Intronic
1060401253 9:123350800-123350822 ACATGAGCTCCCCAGTGGTGAGG + Intergenic
1061657409 9:132103329-132103351 CCCTGTGCACACCTGTGGTCTGG - Intergenic
1062599358 9:137313008-137313030 GCTGGTGCACAGGAGTGGTGAGG + Intronic
1194284322 X:91990847-91990869 ACTTCAGCACAACAGTAGTGAGG - Intronic
1196473701 X:116058463-116058485 ACGTGTTCATGCCAGTGGTGGGG + Intergenic
1196550400 X:117017400-117017422 GCTTGGGCACAGCAGTGGAGAGG + Intergenic
1199690622 X:150306527-150306549 ACTTGTGCACAGCTGAGGTGAGG - Intergenic
1199877573 X:151946553-151946575 ACATGTGCACACCAGAGGATTGG - Intergenic
1200601890 Y:5215406-5215428 ACTTCAGCACAACAGTAGTGAGG - Intronic