ID: 1138297206

View in Genome Browser
Species Human (GRCh38)
Location 16:55897175-55897197
Sequence GCCAAGAGCATCCAACCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138297203_1138297206 13 Left 1138297203 16:55897139-55897161 CCAGGGATGGCTAAGTATTCTAC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1138297206 16:55897175-55897197 GCCAAGAGCATCCAACCCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 157
1138297201_1138297206 26 Left 1138297201 16:55897126-55897148 CCAGCTTGTGTCTCCAGGGATGG 0: 1
1: 0
2: 1
3: 11
4: 188
Right 1138297206 16:55897175-55897197 GCCAAGAGCATCCAACCCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138297206 Original CRISPR GCCAAGAGCATCCAACCCCA GGG Intronic
901690872 1:10972578-10972600 GCCCTGATCATCCAACTCCAGGG - Intronic
901700822 1:11044103-11044125 GCCAAGACCAGCCAGCCCCCTGG + Intronic
902301806 1:15507304-15507326 GCCATGAGCATTCATCCCAAAGG + Intronic
903914513 1:26753819-26753841 GCCAAGGGCATCCCTCACCAGGG + Intronic
904286242 1:29454801-29454823 GCCAAGAGCATCCATCTCCACGG - Intergenic
904417997 1:30374579-30374601 GCCAAGAGCATCCATCTCCATGG + Intergenic
904855030 1:33491426-33491448 GCCAAGAGCAGCCACCCACCAGG + Exonic
904855299 1:33493390-33493412 GCCAAGAGCAGCCACCCACCAGG + Exonic
909600057 1:77451826-77451848 GACAAGACCCTCCTACCCCAGGG + Intronic
916068227 1:161153477-161153499 GCCCCGAGCCCCCAACCCCAAGG - Intronic
917354420 1:174111438-174111460 TACAAGAGCATCCAATCACAGGG - Intergenic
919070697 1:192751513-192751535 GCCTAGTGCATCCCGCCCCAGGG - Intergenic
919738155 1:200966398-200966420 GCAGAGAGACTCCAACCCCACGG + Intergenic
921080672 1:211736506-211736528 GCCAAGTTCTTCCATCCCCAAGG - Intergenic
922328651 1:224554299-224554321 GCCAAGAGAACCCCACCCCACGG - Intronic
1066153603 10:32651034-32651056 GCCATAAGCATCCACTCCCAGGG - Intronic
1069393763 10:67965696-67965718 GACAAGAGCACCCATCCACAAGG + Intronic
1070788077 10:79173903-79173925 GCACAGAGCATCCACCCCAAGGG + Intronic
1070930915 10:80259987-80260009 GCCATTAGCATCCAAGCCAAGGG + Intergenic
1073103057 10:101016920-101016942 CCCCAGAACATCCCACCCCAGGG + Intronic
1075584944 10:123650827-123650849 GCCAAGAGACTTCAACACCAGGG - Intergenic
1076023032 10:127089716-127089738 GACAAGAGCATCCACCACCCAGG - Intronic
1077217820 11:1402377-1402399 CCCATGACCATCCACCCCCAAGG - Intronic
1077550618 11:3198432-3198454 CCCAGGAGCAGCCACCCCCAGGG - Intergenic
1081490204 11:43562004-43562026 CCCAAGAGCATACATCCACATGG - Intronic
1081890463 11:46537502-46537524 GCCAAGGGCACCCTACCGCAAGG + Intronic
1084455866 11:69267868-69267890 GCCAAGAGCCTCCAATGCCCTGG - Intergenic
1086997818 11:93378795-93378817 GCCAAGAGAATCCATCCCTAGGG - Intronic
1088762985 11:112949832-112949854 GGGAAGAGCACCCAACCCAAGGG + Intergenic
1091536414 12:1414190-1414212 GCCAGGGGTCTCCAACCCCAGGG - Intronic
1093655289 12:21687656-21687678 GCCAGGGGCATTCATCCCCAAGG + Intronic
1095487768 12:42702436-42702458 GCCAATTTCATCCATCCCCAGGG - Intergenic
1096504737 12:52085631-52085653 CCCAATAGCAGCAAACCCCAGGG - Intergenic
1100954280 12:99889345-99889367 GACAAGAGCATAAAAGCCCAAGG - Intronic
1101802330 12:108033323-108033345 ACCAAGAGCATCAGGCCCCAGGG - Intergenic
1102786639 12:115610559-115610581 GCAAAGAGAACCCAAACCCAAGG + Intergenic
1103612505 12:122132571-122132593 ACCAAGAGTCTCCCACCCCATGG - Intronic
1105332315 13:19429382-19429404 GCAAAGAGAATCAAAGCCCAAGG + Intronic
1105812604 13:24008386-24008408 GTCAAGATCAGCCAGCCCCAGGG - Intronic
1105879365 13:24590387-24590409 GCAAAGAGAATCAAAGCCCAAGG - Intergenic
1108457870 13:50634636-50634658 ACCAGGAGCCCCCAACCCCAGGG - Intronic
1108625634 13:52225924-52225946 GCAAAGAGAATCAAAGCCCAAGG + Intergenic
1108660430 13:52580495-52580517 GCAAAGAGAATCAAAGCCCAAGG - Intergenic
1115754140 14:36517024-36517046 ACCAAGCGCATCCAATCTCAAGG - Exonic
1118864721 14:69693912-69693934 GCAAAGAGCATCCCTCTCCAGGG - Intronic
1120144274 14:80962444-80962466 GCCAACAGCAACCAGCCCCTAGG - Intronic
1120820830 14:88910456-88910478 GCCAAGAGCATGCTCTCCCACGG + Intergenic
1122711007 14:103658104-103658126 GCCAAGAGCACCCACCCTAAGGG - Intronic
1122804085 14:104247964-104247986 GCCACCAGCGTCCAACCGCAGGG - Intergenic
1123410755 15:20056938-20056960 GCCCTGAGCATCCAGTCCCAGGG + Intergenic
1123520084 15:21063644-21063666 GCCCTGAGCATCCAGTCCCAGGG + Intergenic
1126328792 15:47510072-47510094 TCCAAGAGTCTCCAACCCCTGGG + Intronic
1128655062 15:69454521-69454543 GCTAATAGCATCTAACTCCAGGG + Intronic
1128735725 15:70053022-70053044 GCCAAATGTGTCCAACCCCAAGG + Intronic
1128956464 15:71951701-71951723 ACCAGGAGCATCCTACACCAGGG - Intronic
1129046150 15:72736029-72736051 GCCCAGATCATCCAAATCCAAGG + Intronic
1129368524 15:75071958-75071980 GCCAGGTGTATCCAACTCCAAGG + Intronic
1130013846 15:80172843-80172865 GGCAAGAGCATTCAATGCCAAGG - Intronic
1130882230 15:88065252-88065274 ACCAGGAGCATCCAACACCAGGG + Intronic
1133033343 16:3021915-3021937 GCCAAGCTCCTCCAACCACAAGG + Exonic
1134179487 16:12036038-12036060 ACAAAGAAAATCCAACCCCACGG - Intronic
1134559139 16:15192709-15192731 GCCAAGCTCTTCCTACCCCAGGG + Intergenic
1134919675 16:18104322-18104344 GCCAAGCTCTTCCTACCCCAGGG + Intergenic
1135306226 16:21369829-21369851 ACAAAGAAAATCCAACCCCATGG - Intergenic
1136106382 16:28033141-28033163 GCCCACTGCATCCTACCCCAGGG + Intronic
1136302965 16:29348966-29348988 ACAAAGAAAATCCAACCCCATGG - Intergenic
1137236677 16:46623630-46623652 GGCAGGAGCAACCCACCCCATGG - Intergenic
1137400159 16:48146711-48146733 GCCAAGAGCAGAAAACCCTATGG + Exonic
1138297206 16:55897175-55897197 GCCAAGAGCATCCAACCCCAGGG + Intronic
1140261487 16:73384115-73384137 GCCAAGAGCATCTGACATCATGG - Intergenic
1140393663 16:74609222-74609244 GCCACGAGCCCCCAAACCCACGG + Intergenic
1141285533 16:82668293-82668315 GGCAAGAACTGCCAACCCCAGGG + Intronic
1141914548 16:87086176-87086198 TCCCAGAGCATCCAAGCCCAAGG + Intronic
1141961034 16:87409292-87409314 CCCAAGAACCTCCAACCCCGAGG - Exonic
1142225120 16:88873445-88873467 GCCATGAGTACCCATCCCCATGG - Intergenic
1143442824 17:6988729-6988751 GCGAAGAGGATCCAAACCCAAGG - Intronic
1146053758 17:29571196-29571218 CCCAAGAGCATCCAAATACAGGG - Intronic
1146511401 17:33452259-33452281 GCCAAGAGCAACCAAGGCCAGGG - Intronic
1148001422 17:44389661-44389683 GCCATGAGCATCCACCCTCTGGG - Intergenic
1148831721 17:50437100-50437122 CCCAAGAGGATGCAGCCCCATGG + Intronic
1149328359 17:55556000-55556022 GCCAGGAGCAGCCACCCGCAGGG - Intergenic
1150622898 17:66821818-66821840 CCCAAGAGCATCCATGCCCTGGG - Intergenic
1153658417 18:7305564-7305586 GACAAGAACATCCAACCACCAGG - Intergenic
1156392019 18:36659772-36659794 GGGAAGAACATCCAAGCCCAGGG - Intronic
1160492402 18:79349311-79349333 GCCAAGAGCATCGAAGCCAGTGG - Intronic
1161105918 19:2443989-2444011 ACCAAGAACATCCAACCACAGGG + Intronic
1163282306 19:16325289-16325311 GCCCAGGCCATCCAGCCCCATGG - Exonic
1167380284 19:49134394-49134416 TCCCAAAGCCTCCAACCCCATGG + Intronic
1167952048 19:53035749-53035771 GGCAAGAACAGCCCACCCCAAGG + Intergenic
925538334 2:4939811-4939833 GGCAAGAGTCTCCAACCCCTGGG - Intergenic
927452969 2:23224480-23224502 GCCAGGAGCCACCAACCACACGG + Intergenic
937352944 2:121178538-121178560 GCCAGGAACAACGAACCCCAGGG - Intergenic
939723329 2:145682143-145682165 GCCAAAGGCATCTAACTCCAGGG + Intergenic
939838588 2:147158829-147158851 CCCAAGAGGGTGCAACCCCAGGG - Intergenic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
944969125 2:204971414-204971436 GCAAAGAGCTTCCAACAACAAGG - Intronic
946252097 2:218419921-218419943 GCCAAGACCCTCCAGCCCAAAGG - Intronic
946312838 2:218892468-218892490 AGCAAGAGCCTCCAGCCCCAAGG + Intronic
948146425 2:235711544-235711566 ACCAACAGCATCGAAGCCCACGG - Intronic
1170181568 20:13536243-13536265 TCTAACAGCATCCCACCCCAGGG + Intronic
1170505711 20:17023929-17023951 GGCAGGAGCCTCCAACCCCTGGG + Intergenic
1171344444 20:24455203-24455225 GCCAAGAACATCCAAAGCAAAGG - Intergenic
1175749068 20:61482662-61482684 TCCAGGAGCATCCAACCACATGG - Intronic
1175985410 20:62761966-62761988 CCCAAGGGCCACCAACCCCAGGG + Exonic
1176740700 21:10599168-10599190 GCAAAGAGAATCAAAGCCCAAGG - Intronic
1178499106 21:33110980-33111002 GCTAATAGTATCCAACCTCAGGG - Intergenic
1178692311 21:34760282-34760304 GCCTAGAGCAGCCCTCCCCATGG + Intergenic
1181019115 22:20089303-20089325 GCAAAGCTCATCCAGCCCCAAGG + Intronic
1181045251 22:20211239-20211261 GCCAGGGGCACCCAACCCCTTGG - Intergenic
1181459325 22:23076946-23076968 GCCCAGAGCTTCCAACTCAAAGG - Intronic
1182979449 22:34654677-34654699 GCCAAGGGTCTCCAACCCCTAGG - Intergenic
950863714 3:16172455-16172477 ACCAAGAACAGCCCACCCCAGGG - Intergenic
953728001 3:45417492-45417514 TCCAAAAGCATCCCATCCCATGG - Exonic
954610092 3:51940369-51940391 TCCAAGAGCCTCCAACCCACAGG + Intronic
961749797 3:129088328-129088350 GGCAGGAGCAACCCACCCCATGG - Exonic
962396022 3:135015908-135015930 GCCAAGATCTTCCCACCTCAGGG - Intronic
966849794 3:184157142-184157164 ACCAGGAGCACCCCACCCCAGGG - Intronic
968730302 4:2266293-2266315 AGCAAGAGCCTCCAACCCCTCGG + Intergenic
968834277 4:2951585-2951607 GCCAAGAGCAAGCAGCTCCACGG + Intronic
973890643 4:55364290-55364312 GCCAGGAGCTCCCCACCCCAGGG + Intronic
974279367 4:59772257-59772279 TCCTAGAGCACCCAACACCAAGG - Intergenic
978108255 4:104930761-104930783 GCTTAGAGGATCCCACCCCAAGG + Intergenic
979388687 4:120100693-120100715 GCCCAGAGCATACAGGCCCAGGG - Intergenic
981288199 4:143044797-143044819 ACGAGGAGCAGCCAACCCCAAGG - Intergenic
983019619 4:162659560-162659582 GCCAAGATATTCCAGCCCCAGGG + Intergenic
990489847 5:56294013-56294035 CCCAACAGCATCCACACCCATGG + Intergenic
991088221 5:62667896-62667918 GCCAAGAGCATCCTGCCTTAGGG - Intergenic
998270996 5:140706352-140706374 GCCAAGAACATCAGGCCCCAGGG - Exonic
1002212328 5:177606356-177606378 GCAAAGAGCTTCCATTCCCATGG - Intronic
1003913752 6:10766416-10766438 GCCAAGAGCTCCCCACTCCATGG + Intronic
1011169586 6:84490677-84490699 GCAAGGAGGATCCACCCCCACGG + Intergenic
1015603936 6:134936729-134936751 GACATTAGCATCCAAGCCCAAGG - Intronic
1015683183 6:135830662-135830684 GCCAAATACATCCACCCCCACGG - Intergenic
1017787632 6:157769593-157769615 GCCAGGAGCATCCCTCCCGAGGG + Intronic
1018468884 6:164079442-164079464 GCCAAGACCATGCATCCCCTGGG - Intergenic
1019410391 7:904193-904215 GCCAAGATCGGCCACCCCCACGG - Exonic
1020632790 7:10660425-10660447 GCCCAGAGCATCAAAGCACAAGG - Intergenic
1020769388 7:12369211-12369233 GCCAAGATCATTTAACCTCAGGG - Intronic
1026351113 7:69516189-69516211 GCCAAGAGCATCTAAGCCAGAGG + Intergenic
1026429291 7:70327653-70327675 GCCCAGAACATCCAAATCCATGG - Intronic
1028631368 7:92938077-92938099 GCCAAAGGCAACCCACCCCAGGG - Intergenic
1030335721 7:108323944-108323966 GCAAAGAGATTCCAACCTCAGGG - Intronic
1032894509 7:136235832-136235854 ACCCAGACCATCCAACTCCAAGG + Intergenic
1037914204 8:22762564-22762586 GTCAATATCATCCATCCCCAGGG - Intronic
1042604757 8:70534247-70534269 GCCTCAAGCATCCAACCACAAGG + Intergenic
1044560651 8:93608786-93608808 GGCAGGGGCATCCACCCCCAGGG - Intergenic
1048439099 8:134446832-134446854 GCCAAGCTCACCTAACCCCAGGG - Intergenic
1049011713 8:139891766-139891788 GCCAAGAGCTCCCATCTCCAGGG + Intronic
1056404896 9:86264058-86264080 GCGAAGAGCATCGATCACCATGG - Intergenic
1056814582 9:89792110-89792132 GCCAGGAGCATCGACCTCCATGG + Intergenic
1057098864 9:92338813-92338835 TACAAGATCATCCAGCCCCAAGG - Intronic
1059427870 9:114232326-114232348 GGCAAGGGCAGCCACCCCCATGG - Intronic
1059918996 9:119136765-119136787 GCCATGAGGGTCCAACCTCATGG + Intergenic
1060601311 9:124880081-124880103 GCCAGGAACAGCCAACTCCATGG - Exonic
1061796222 9:133087287-133087309 GCCGAGAGGGTGCAACCCCAGGG + Intronic
1061935806 9:133857038-133857060 TCCAAGAGCATCCCTGCCCAAGG + Intronic
1186850451 X:13574658-13574680 GCCAAGAGCATCCACCAAGATGG - Intronic
1187940639 X:24377549-24377571 GACAAAAGAATCCAATCCCATGG + Intergenic
1190319121 X:49169497-49169519 GCCAGGAGGATTCAACCCAAGGG - Intergenic
1190828409 X:54039342-54039364 AGCAAGAGCAGCCACCCCCAAGG + Intronic
1192246388 X:69375420-69375442 ACCAAGAACAGCAAACCCCAGGG + Intergenic
1194585305 X:95725830-95725852 GCCATGAGTATCCAACTCCAGGG - Intergenic
1198277841 X:135113028-135113050 GCCATAAGCATCCACCCCCAAGG - Intergenic
1201754907 Y:17476500-17476522 GCCATGAGAATCCGACCTCATGG - Intergenic
1201846645 Y:18429485-18429507 GCCATGAGAATCCGACCTCATGG + Intergenic
1202276486 Y:23126202-23126224 GCCAAGAGCAGGCAAGCCAAGGG - Intergenic
1202289542 Y:23294488-23294510 GCCAAGAGCAGGCAAGCCAAGGG + Intergenic
1202429480 Y:24759924-24759946 GCCAAGAGCAGGCAAGCCAAGGG - Intergenic
1202441311 Y:24910166-24910188 GCCAAGAGCAGGCAAGCCAAGGG + Intergenic
1202598970 Y:26573038-26573060 GCAAAGAGAATCAAAGCCCAAGG - Intergenic