ID: 1138297206

View in Genome Browser
Species Human (GRCh38)
Location 16:55897175-55897197
Sequence GCCAAGAGCATCCAACCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138297201_1138297206 26 Left 1138297201 16:55897126-55897148 CCAGCTTGTGTCTCCAGGGATGG 0: 1
1: 0
2: 1
3: 11
4: 188
Right 1138297206 16:55897175-55897197 GCCAAGAGCATCCAACCCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 157
1138297203_1138297206 13 Left 1138297203 16:55897139-55897161 CCAGGGATGGCTAAGTATTCTAC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1138297206 16:55897175-55897197 GCCAAGAGCATCCAACCCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138297206 Original CRISPR GCCAAGAGCATCCAACCCCA GGG Intronic