ID: 1138297383

View in Genome Browser
Species Human (GRCh38)
Location 16:55898738-55898760
Sequence CTCAGCCTCTCCCATGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 9, 3: 65, 4: 484}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138297383_1138297390 14 Left 1138297383 16:55898738-55898760 CCAGCACCATGGGAGAGGCTGAG 0: 1
1: 0
2: 9
3: 65
4: 484
Right 1138297390 16:55898775-55898797 ATCATCTGACCAGGAAGACCAGG 0: 1
1: 0
2: 0
3: 10
4: 143
1138297383_1138297394 23 Left 1138297383 16:55898738-55898760 CCAGCACCATGGGAGAGGCTGAG 0: 1
1: 0
2: 9
3: 65
4: 484
Right 1138297394 16:55898784-55898806 CCAGGAAGACCAGGGCATGGTGG 0: 1
1: 0
2: 3
3: 66
4: 481
1138297383_1138297389 5 Left 1138297383 16:55898738-55898760 CCAGCACCATGGGAGAGGCTGAG 0: 1
1: 0
2: 9
3: 65
4: 484
Right 1138297389 16:55898766-55898788 TCTTGGAAGATCATCTGACCAGG 0: 1
1: 0
2: 0
3: 4
4: 125
1138297383_1138297392 20 Left 1138297383 16:55898738-55898760 CCAGCACCATGGGAGAGGCTGAG 0: 1
1: 0
2: 9
3: 65
4: 484
Right 1138297392 16:55898781-55898803 TGACCAGGAAGACCAGGGCATGG 0: 1
1: 0
2: 2
3: 43
4: 347
1138297383_1138297391 15 Left 1138297383 16:55898738-55898760 CCAGCACCATGGGAGAGGCTGAG 0: 1
1: 0
2: 9
3: 65
4: 484
Right 1138297391 16:55898776-55898798 TCATCTGACCAGGAAGACCAGGG 0: 1
1: 0
2: 2
3: 19
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138297383 Original CRISPR CTCAGCCTCTCCCATGGTGC TGG (reversed) Intronic
900138150 1:1127553-1127575 CACAGCCACTCCCAGGGGGCTGG + Intergenic
900401032 1:2472975-2472997 CTCCGCCTCTCCCCTGGGGAAGG - Intronic
900647289 1:3714698-3714720 CTCAGCCTCTGCCCTGGGCCGGG - Intronic
900803356 1:4751270-4751292 CACAGCCTCTTCCCTGGTGGAGG + Intronic
901085714 1:6611060-6611082 CTCAGCCTCCCCCAAAGTGCTGG - Intronic
901203877 1:7483071-7483093 CTCAGCCTCTCTCAGGAAGCTGG + Intronic
901211808 1:7530929-7530951 CTCAGCCTCCCCCAAGTAGCTGG + Intronic
901526424 1:9825552-9825574 GTCATCCTCTCCCCTGGTGACGG + Intergenic
901569392 1:10147239-10147261 CTCAGCCTCCCCCAAAGTGCTGG - Intronic
901673584 1:10869777-10869799 CTCTGCCTCTCCCATCATCCTGG + Intergenic
902355243 1:15893784-15893806 CTTAGCCTCCCCCAAAGTGCTGG - Intronic
902399996 1:16152461-16152483 CACAGCCTCTGTCATGGGGCCGG - Intronic
902606006 1:17569733-17569755 CCCAGCCTTTCCCACGGGGCAGG - Intronic
903111172 1:21135382-21135404 CTCAGCCTCTCCCGAGTAGCTGG - Intronic
903410028 1:23134664-23134686 CTCAGCCTCTCCCAAGTAGCTGG - Intronic
903414961 1:23176311-23176333 CTCAGCCTCCCCAAAAGTGCTGG + Intronic
903921964 1:26806105-26806127 CTCAGCCCCTCCCAAGTAGCTGG + Intergenic
904000630 1:27336508-27336530 CGCAGACTCAACCATGGTGCTGG - Intergenic
904168511 1:28574467-28574489 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
906283136 1:44567434-44567456 CTCAGCCCCTTCCCTGGAGCAGG - Intronic
906490134 1:46261876-46261898 CTCAGCCTCTCAAAAAGTGCTGG - Intronic
906543186 1:46603914-46603936 CTCAGTCTCTCCCAGGGATCAGG - Intronic
906689179 1:47781436-47781458 CTCAGCCCGGCCGATGGTGCAGG + Intronic
906746730 1:48226909-48226931 CTCAGGCGGTCCCAGGGTGCTGG - Intronic
907112179 1:51936148-51936170 CTCAGCCTCTCCGATTCTGAAGG + Intronic
907516133 1:54994580-54994602 CTCAGCCTCTTTCATGATGCTGG - Intergenic
910308259 1:85792435-85792457 CTTAGCCTCTACCAAAGTGCTGG - Intronic
910402884 1:86854900-86854922 CTTGGCCTCTCCCAAAGTGCTGG + Intergenic
910542769 1:88379536-88379558 CACAGACTCTCCAAGGGTGCTGG + Intergenic
910901033 1:92121012-92121034 CTCAGCCTCCCCCAGAGTGCTGG + Intronic
912328769 1:108797101-108797123 CTCAGCGTCTCCCAGAGTGTTGG - Intronic
912379023 1:109236636-109236658 CTCAGATTTTCCCATGATGCTGG - Intronic
912759256 1:112352274-112352296 CTCAGCCTTCTCCATGGTGAGGG + Intergenic
913557829 1:119986708-119986730 CACAGCATCTAGCATGGTGCTGG + Intronic
914685628 1:149976358-149976380 CTCGGCCTCTCCCAAAGTGCTGG - Intronic
915229160 1:154432998-154433020 CTCAGCCTCTGCCTTGGACCAGG + Intronic
915497429 1:156291876-156291898 CTGTGCCTCTCCCCTGGTCCTGG - Exonic
917459983 1:175221447-175221469 CTCAACCTCACCCCTGTTGCCGG - Intergenic
917912973 1:179670273-179670295 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
918293965 1:183137676-183137698 TTCAGCTTCTGCCTTGGTGCTGG - Exonic
919002183 1:191847063-191847085 CTCGGCCTCTCCCAAAGTGCTGG - Intergenic
920880407 1:209875193-209875215 CTCAGCCCCTCCCAAGTAGCTGG - Intergenic
921709982 1:218364299-218364321 CTCAGCCTAACACCTGGTGCTGG - Intronic
921850784 1:219929884-219929906 CTCAGCCTCTTCCAGAGTCCTGG - Intronic
922741254 1:228015557-228015579 CTCAGCCTCTCCCCGGGGACTGG + Intronic
923255684 1:232219491-232219513 CCCAGCTCCTCCCAGGGTGCTGG + Intergenic
923695851 1:236250353-236250375 CTCAGCCTCTCCCGAGTAGCTGG - Intronic
923976080 1:239264770-239264792 CTCAGTCTCTCCCAAGTAGCTGG - Intergenic
1065066317 10:21968970-21968992 CTCAGCCTGGCCCAAAGTGCTGG - Intronic
1065916118 10:30356153-30356175 CTCAGCCCCTCCAACGGTACCGG - Intronic
1067016866 10:42763740-42763762 CTCAGCCCCTCCCAAGTAGCTGG + Intergenic
1067476724 10:46572367-46572389 CTCCCCATCTCCCATGGTGAGGG + Intergenic
1067618013 10:47769413-47769435 CTCCCCATCTCCCATGGTGAGGG - Intergenic
1068071939 10:52206779-52206801 CTCAGCCTCTCCAGTGCAGCAGG - Intronic
1068655989 10:59577110-59577132 CTCAGACACTGCCATGGGGCTGG - Intergenic
1069384279 10:67870331-67870353 CTCAGCCTTTCCCAAATTGCTGG - Intergenic
1070235928 10:74626414-74626436 CTCAGCCTCTTCCAAGTAGCTGG + Intronic
1073984464 10:109192772-109192794 CTCAGTCTCTACCATGCTGGAGG + Intergenic
1075111664 10:119591288-119591310 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
1076352952 10:129831326-129831348 CTGAGCCCATCCTATGGTGCAGG - Intergenic
1076401348 10:130187481-130187503 CTCAGCTTCTGCCAGGATGCTGG + Intergenic
1076794453 10:132791855-132791877 CTCAGCCTCAGCCCTGCTGCGGG + Intergenic
1077019295 11:410449-410471 CTGGGCATCTCCCATGGTGTAGG - Intronic
1077350851 11:2092596-2092618 CTCAGCCTCTGCCATCAGGCTGG - Intergenic
1077472981 11:2773003-2773025 CTCTGGCTCTGGCATGGTGCTGG + Intronic
1077885359 11:6383420-6383442 CTCCGCCTCCCCTATAGTGCTGG + Intergenic
1078387329 11:10903945-10903967 CTCAGGCCCCCCCATGCTGCTGG - Intergenic
1079244892 11:18744713-18744735 CCCAGCCCCTCTCATCGTGCAGG - Intronic
1079395127 11:20055825-20055847 CACAGCCTCTCCAATGCTGATGG + Exonic
1079918529 11:26401623-26401645 CTCGGCCTCTCCCAAAGTACTGG - Intronic
1080462299 11:32465862-32465884 CTCAGCCTCCTCCAAAGTGCTGG + Intergenic
1083282175 11:61633861-61633883 CTCAGCCTCCCACAGGGTGGGGG - Intergenic
1083762424 11:64825949-64825971 CTCAGCCTCTCCCAAGTCGCTGG - Intronic
1083805414 11:65070731-65070753 CTCCTCCTCTCCCAAAGTGCTGG + Intronic
1084013505 11:66365649-66365671 CTCAGTCCCTCACCTGGTGCAGG + Intronic
1084542946 11:69798602-69798624 CTCAGCTCCTCCCATAGTGTTGG - Intergenic
1084718384 11:70888563-70888585 CTCAGCCTCACCCAAAGTCCTGG - Intronic
1085119316 11:73957157-73957179 CTCAGCCTTCCACATGGAGCCGG + Intronic
1085731463 11:79002437-79002459 CTCAGCCCCTCCAATGCAGCAGG + Intronic
1087752112 11:102018374-102018396 CTCGGCCCCTCCCAAAGTGCTGG - Intergenic
1087810046 11:102600733-102600755 CGCCGCCTCTCCCAAAGTGCTGG + Intronic
1088608453 11:111554030-111554052 ACCAGCCTCTGCCTTGGTGCTGG + Intronic
1089097104 11:115928182-115928204 CTTAGGCTCTCACATGGTCCTGG + Intergenic
1090427319 11:126617179-126617201 CTCAGCTTCTCCCATTCTGTGGG - Intronic
1090574583 11:128086905-128086927 CTCACCCTTTCCCATGTTGTAGG + Intergenic
1091095092 11:132813420-132813442 CTCAGGTTCTACCATTGTGCTGG - Intronic
1091292802 11:134451567-134451589 CTCAGCGTCAGCCATGGTGAGGG - Intergenic
1091292816 11:134451637-134451659 CTCAGCGTCAGCCATGGTGAGGG - Intergenic
1091292830 11:134451707-134451729 CTCAGCGTCAGCCATGGTGAGGG - Intergenic
1091292843 11:134451777-134451799 CTCAGCGTCAGCCATGGTGAGGG - Intergenic
1092052536 12:5482382-5482404 CTTCGTCTTTCCCATGGTGCTGG + Intronic
1092785810 12:12025576-12025598 CTCAGCCTCTCCTAAGATGCTGG - Intergenic
1093437103 12:19148379-19148401 CTCAGGCTCTGCAAAGGTGCTGG + Intronic
1094251242 12:28364269-28364291 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
1094291984 12:28861335-28861357 CTCAGCCTCACCCAAAGTGCTGG + Intergenic
1095879687 12:47119848-47119870 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
1095981198 12:47975701-47975723 CTCCGCCCCACCCATGGGGCTGG - Intronic
1096358361 12:50962292-50962314 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
1096705467 12:53418809-53418831 CTCGGCCTCTCTCAAAGTGCTGG + Intergenic
1096984067 12:55744893-55744915 CTGTGCCTCTCCCATGGGGGTGG - Intronic
1097681928 12:62657179-62657201 CTCACCCTCTCTCATGGGGGTGG - Intronic
1100190923 12:92190822-92190844 CTCAGCCTCCCCCAAAGTGCTGG - Intergenic
1101331013 12:103758002-103758024 CTCAAACTCTCCCACGGCGCAGG + Intronic
1101736319 12:107465968-107465990 CTCAGCCTCTAGCACGATGCTGG - Intronic
1101992036 12:109494075-109494097 CTCAGCCTCTCAAAAAGTGCTGG + Intronic
1102525248 12:113507984-113508006 CTCAGCCTCCCCCAAAGCGCTGG + Intergenic
1102609197 12:114096309-114096331 CTCAGCCTCCCCCAAAGTGGTGG + Intergenic
1103545594 12:121698887-121698909 CTCAGCCTTTCCCAAAGTGCTGG - Intergenic
1103862986 12:124029080-124029102 CTCAGCCTCCCCCAAGCAGCTGG + Intronic
1103866128 12:124053397-124053419 CTCAGCCTCTCCCAAAGTGCTGG - Intronic
1103939016 12:124491951-124491973 CTCAGCCTCAGCCATGCTCCAGG - Intronic
1104023419 12:125009090-125009112 CTCAGTCTCTCCCAAGTAGCTGG + Intronic
1104645998 12:130497588-130497610 CTCAGCCTCTCCCCAGCTCCTGG - Intronic
1104951001 12:132440057-132440079 CCCATCCTCCCCCATGGTGGAGG + Intergenic
1105355716 13:19657686-19657708 CTCAGCCTTTCCAGTGGTTCTGG + Intronic
1105763693 13:23537192-23537214 CTTAGCCTCCCCCAAAGTGCTGG - Intergenic
1105988659 13:25595519-25595541 CTCAGCCCTTCCCATTTTGCTGG + Intronic
1106183406 13:27387249-27387271 CTTGGCCTCTCCCAAAGTGCTGG + Intergenic
1106214645 13:27685292-27685314 CTCAGCCTCCCAAATAGTGCTGG + Intergenic
1106272148 13:28165370-28165392 CTTAGCCTCCCCCAAAGTGCTGG + Intronic
1107668379 13:42716551-42716573 CTCAGCCCTTCCCAATGTGCTGG + Intergenic
1107901715 13:45022781-45022803 CTCAGTCTCCCCCAAAGTGCTGG - Intronic
1108995739 13:56732246-56732268 CTCAGCCTCTCACAAAGTGTTGG - Intergenic
1111894624 13:94126126-94126148 CTCTGCCTCTCCCAAAGTGTTGG - Intronic
1112306558 13:98279969-98279991 TTCAGCCTCTCCCTTGCTCCTGG + Intronic
1113143549 13:107182387-107182409 CTCAGCCTCTCTCAAGTAGCTGG + Intronic
1113698602 13:112366139-112366161 CTCAGCCTAGCCAATGCTGCTGG + Intergenic
1114081838 14:19207716-19207738 CTCAACCTCCCAAATGGTGCTGG - Intergenic
1114263371 14:21055794-21055816 CTGAGCCTCTCCCATTGGGATGG - Intronic
1114410825 14:22498681-22498703 CTCTGCCTCTCCCATAGGGTTGG - Intergenic
1114493924 14:23119695-23119717 CTCTGGCTCTCCCCTGCTGCTGG + Intergenic
1114559218 14:23578585-23578607 CCCAGCCTCCCCCGTGATGCTGG - Exonic
1114636474 14:24189885-24189907 CCCACCCTCTCCCATGTTGCTGG + Intronic
1117392934 14:55279783-55279805 CACTTCCTCTCCCATGATGCTGG - Intronic
1117902668 14:60551224-60551246 CACAGCCTGTTCCATGCTGCTGG + Intergenic
1118618347 14:67591782-67591804 CTCAGCCTCCCCCACAGTGTTGG + Intronic
1118742349 14:68748723-68748745 CTCAGCCTCCTCCATGGCCCAGG - Intergenic
1119104775 14:71913553-71913575 TCCAGCCTCTCTCATGGAGCTGG - Intergenic
1119302113 14:73579666-73579688 CTTGGCCTCTCCCAAAGTGCTGG + Intergenic
1119741151 14:77014450-77014472 AGCCGCCTCTCCCAGGGTGCTGG + Intergenic
1120505450 14:85349725-85349747 CTCAGCCTAGGCCAAGGTGCAGG - Intergenic
1121288081 14:92752087-92752109 CTCAGCCTCCTCCCTGCTGCTGG - Intergenic
1121449235 14:93996924-93996946 CTCAGCCCCACCCATGGCTCAGG - Intergenic
1121454543 14:94029931-94029953 CTCTGCCTTTCCCAAGATGCAGG - Intronic
1121718946 14:96095940-96095962 CTCAGGCTCCCGCAGGGTGCTGG + Intergenic
1122048153 14:99038006-99038028 CTGAGCCTCTCCCAGGGCCCGGG + Intergenic
1122458052 14:101871356-101871378 CTCAGCCTCCCCCAAGTAGCTGG + Intronic
1122567399 14:102670200-102670222 CTTGGCCTCTCCCAAAGTGCTGG + Intronic
1122836114 14:104431931-104431953 CTCTGCCTGCCCCATGGTGGTGG + Intergenic
1122875029 14:104659973-104659995 CCCAGTTTCTCCCATGGAGCTGG + Intergenic
1122930464 14:104931065-104931087 CACAGCCCCACCCATGGTGCTGG - Intronic
1123201915 14:106674283-106674305 GTCAGCCTCTCCCACGTGGCTGG + Intergenic
1124031221 15:26014003-26014025 CACAGCCTCTCCAACGCTGCGGG - Intergenic
1124505243 15:30266977-30266999 CTCAGCCTCTCACAGGCTGAGGG - Intergenic
1124738309 15:32271658-32271680 CTCAGCCTCTCACAGGCTGAGGG + Intergenic
1125611680 15:40975724-40975746 ATCAGCCTCTACCATAGTGCTGG - Intergenic
1125646596 15:41277838-41277860 CTCAGCCTCCCCCAAGGAACTGG - Intronic
1127734781 15:61830561-61830583 CAGAGCCTCTCACATGCTGCAGG + Intergenic
1127735006 15:61831722-61831744 CACTGCCTCTCCCAGGGTGGAGG + Intergenic
1128262080 15:66239624-66239646 CCCAGCCTCCCCCAGGGTGAGGG + Intronic
1128342702 15:66833824-66833846 CTCAGCCTCCCCCATAGGGAAGG - Intergenic
1128880177 15:71235701-71235723 CTCAGCCTCTCCCGAGTAGCTGG + Intronic
1130002949 15:80063663-80063685 CTCAGCCTCTCCCCAGTAGCTGG + Intronic
1130048084 15:80461538-80461560 GCCAGCCTCTCCCATGGTGGTGG - Intronic
1130060258 15:80564440-80564462 CTCAGCCTCTGCCCTGCTCCTGG + Intronic
1131742959 15:95414257-95414279 CTCCCCCTCTCCCATAGTGGTGG - Intergenic
1131879103 15:96843668-96843690 CTCAGCCTCCCCCAAGTAGCTGG + Intergenic
1132085867 15:98907853-98907875 CTCAGCCTCTCCTAGATTGCTGG + Intronic
1132610146 16:811819-811841 CTCAGCCTCTCGCATGGGACTGG - Intronic
1132647168 16:1004423-1004445 TCCAGCCTTGCCCATGGTGCGGG + Intergenic
1132843000 16:1987345-1987367 CTCAGCCTTTCCCTGGGCGCAGG + Exonic
1133018524 16:2955797-2955819 CCCCGCATCTGCCATGGTGCTGG + Intergenic
1134028211 16:10970861-10970883 CTCAGCCTCTCCCAAGTAGCTGG + Intronic
1134160535 16:11884815-11884837 CTCGGCCTCCCCCAAGGTGCTGG - Intronic
1134222045 16:12362585-12362607 CTCATGCTCCCCCAGGGTGCTGG + Intronic
1134266096 16:12693952-12693974 CTCAGCCCCTCCTAAAGTGCTGG - Intronic
1134810932 16:17166481-17166503 CTGAGCCCTTCCCATGGGGCAGG - Intronic
1135261178 16:20982267-20982289 CTCAGCCTCCCCCAAGCAGCTGG - Intronic
1135397976 16:22145935-22145957 CTCAGCCTCCCCCAAGCAGCTGG + Intronic
1135880785 16:26253950-26253972 CTCAGCCTCTCTCAAGTAGCTGG - Intergenic
1136037900 16:27554346-27554368 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
1136221890 16:28834546-28834568 CTCAGCCCCGCCGATGATGCAGG + Exonic
1137542920 16:49377277-49377299 CCCGGCCTCTCCCTTGGTCCCGG - Intronic
1137562550 16:49512131-49512153 CTAAGCCCCTCACATGTTGCAGG - Intronic
1137990665 16:53151366-53151388 CTCAGCCTCTCCCAAGTAGCTGG + Intronic
1138297383 16:55898738-55898760 CTCAGCCTCTCCCATGGTGCTGG - Intronic
1139903214 16:70344524-70344546 CTCAGCCTCTCCCGAGTAGCTGG + Intronic
1141237397 16:82231193-82231215 CTCAGCCTATGCCATTCTGCAGG - Intergenic
1141700532 16:85640127-85640149 CCCAGCACCACCCATGGTGCAGG + Intronic
1141997469 16:87644663-87644685 CTCAGCCTCGCCCAGGCTGATGG - Exonic
1142278050 16:89133270-89133292 CTCCTCCACTCCCATGGGGCTGG - Intronic
1142376185 16:89708210-89708232 CTCAGCCTCTCCCAGACAGCAGG - Intronic
1142414928 16:89936190-89936212 CTCATCCTCTCCCAGGCTGGCGG + Intergenic
1142762185 17:2049333-2049355 CTCAGCCTATCTCTAGGTGCTGG - Intergenic
1142817889 17:2441784-2441806 CTTAGCCTCTCCAATGCTTCAGG + Intronic
1142886526 17:2915947-2915969 CTCAGCCTCTCCCAAAGTGCTGG + Intronic
1143101983 17:4509573-4509595 CTCAGCCTCTCCCTGGCTTCCGG - Intronic
1143560723 17:7692866-7692888 CTCAGCCTCTCCCGAGTAGCTGG + Intronic
1143753130 17:9045582-9045604 TTCAGCCTTTCTCATGGTTCTGG - Intronic
1143869805 17:9949976-9949998 CTCAGCCTCTCCCGGGTAGCTGG + Intronic
1143906607 17:10214199-10214221 CTCAGCCTCTCCCAAGTAGCTGG - Intergenic
1144384691 17:14738383-14738405 ATCAGGCTCTCCCAGGGTCCAGG - Intergenic
1144554066 17:16266270-16266292 CTTAGCCTCCCCCATCATGCAGG - Intronic
1144831386 17:18133203-18133225 CTCAGCCTCTGCCCTCATGCAGG + Exonic
1145216253 17:21054741-21054763 GCCAGGCTCTCCCATGGTGATGG - Intergenic
1145761928 17:27430168-27430190 CTAGGCCTGTCCCATGGTCCCGG - Intergenic
1145770696 17:27490885-27490907 CTCAGCCTTTCCCCTGTTACTGG - Intronic
1146022832 17:29293572-29293594 CTGGGCCTCTCCCATGCTGGAGG + Intronic
1146076023 17:29730067-29730089 CTCAGCCTCTCCCGAAGTGCTGG - Intronic
1146434181 17:32828038-32828060 TTCAGCCTCTCCCATGCTCAGGG - Intronic
1147673812 17:42191707-42191729 CTCAGCCTCTCCCAAAGTGCTGG + Intronic
1147680181 17:42238399-42238421 GTCAGCCTCCCCCAGAGTGCTGG + Intronic
1147973714 17:44235597-44235619 CTCAGCCCCTCCCAAGGTGCTGG + Intergenic
1148080137 17:44963394-44963416 ATCAGCCTCTCCCCTGGTGGTGG - Intronic
1148333787 17:46828075-46828097 CTCGGCCTATCCCAAAGTGCTGG + Intronic
1148663500 17:49356310-49356332 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
1149832376 17:59883517-59883539 CTCGGCCTCTCGCAAAGTGCTGG + Intronic
1150127379 17:62646712-62646734 CTCACCCTCTCCAAATGTGCTGG + Intronic
1150724288 17:67638857-67638879 CTCAGCCTCCCCCAAAGTGCTGG - Intronic
1150777271 17:68091359-68091381 CTCAGCCTCTCCCGAGTAGCTGG - Intergenic
1150868070 17:68875658-68875680 CTCAGCCTCTGCCATGTAGTGGG + Exonic
1150877282 17:68984100-68984122 CTCAGCCTCTGCCATGTAGTGGG + Exonic
1150965852 17:69967554-69967576 CTCAGCCTCTCCCAGGTAGCTGG - Intergenic
1151230704 17:72683169-72683191 CTCAGACTTTCCCATGTAGCTGG + Intronic
1151535857 17:74738401-74738423 CTCCTCCTCTCCGAGGGTGCAGG - Intronic
1151553897 17:74837022-74837044 CACTGCATCTCCCATTGTGCAGG - Exonic
1151682905 17:75631069-75631091 CTCAGCCCCTTCTCTGGTGCTGG - Intronic
1151952676 17:77363861-77363883 CTCAGCCTCTGGCCTGGTTCCGG + Intronic
1152227339 17:79098569-79098591 CCCAGCCTCTCCCTTCCTGCAGG + Intronic
1152487004 17:80601093-80601115 GGCAGCCTCTCCGATGGGGCTGG - Intronic
1152570302 17:81118761-81118783 GTCAGCCTCACCCCTGGTGCAGG - Intronic
1153326147 18:3822396-3822418 CCCAGCCCCTGCTATGGTGCTGG - Intronic
1153891997 18:9526002-9526024 CTCGGCCTCCCCCAGAGTGCTGG + Intronic
1158326760 18:56321189-56321211 CAAAGCCTCTCTCCTGGTGCTGG - Intergenic
1158763727 18:60422132-60422154 CTCCACCTCTCCCAAAGTGCTGG + Intergenic
1160203375 18:76813437-76813459 CTCGGCCTCTCCCTCAGTGCTGG + Intronic
1161555409 19:4939309-4939331 CTCAGCCTCCCAAAAGGTGCTGG + Intronic
1161635990 19:5389210-5389232 CTCGGCCTCCCCCAAAGTGCTGG - Intergenic
1161790529 19:6357159-6357181 CTCAGTCTCTCCCAAGTAGCTGG + Intergenic
1162056096 19:8065101-8065123 CTCAGCCTCTCCCAAGTAGCTGG - Intronic
1162478052 19:10912723-10912745 CTCTGCCTCTCCCATGGATCTGG + Intronic
1165221568 19:34320835-34320857 CTCAGCCTCTTCCAAGTAGCTGG + Intronic
1165256066 19:34577820-34577842 CCCAGCCCCTCCCATGGTGCTGG + Intergenic
1165408211 19:35643283-35643305 CTCAGGCTCTTCCGTGGTCCGGG + Exonic
1165520893 19:36313006-36313028 ATCAGCCTCTCCCATTGGGTGGG + Intergenic
1165623179 19:37265580-37265602 ATCAGCCTCTCCCATTGGGTGGG - Intergenic
1165635018 19:37333441-37333463 ATCAGCCTCTCCCATTGAGAGGG - Intronic
1165741702 19:38208733-38208755 CTCAGCCTCTCAAAAAGTGCTGG - Intergenic
1166537630 19:43584961-43584983 CTCAGCCTCCCCCATGTAGTTGG + Exonic
1166835318 19:45664149-45664171 CTAAACTTCTCCCAAGGTGCTGG + Intergenic
1167095970 19:47375330-47375352 AACAGCCCCTCGCATGGTGCTGG - Intronic
1167359846 19:49024161-49024183 CTCCGCCTCACCCTTGGCGCTGG - Exonic
1167363713 19:49043998-49044020 CTCCGCCTCACCCTTGGCGCTGG + Exonic
1167364782 19:49048929-49048951 CTCCGCCTCACCCTTGGCGCTGG - Exonic
1167525196 19:49979258-49979280 CTCAGGCTCTCCCTTGCTGGGGG - Intronic
1167585828 19:50375230-50375252 CTCAGCCTCTCCCGAGTAGCTGG + Intronic
1167748086 19:51364530-51364552 ATCCGTCTCCCCCATGGTGCAGG - Intronic
1167843741 19:52142695-52142717 CTCAGCCTCTCTCAATGTGCTGG - Intergenic
1168318079 19:55492910-55492932 CTCAGCCTCTCCCAAGTAGCTGG - Intronic
926753233 2:16216293-16216315 CTAATCCTCGGCCATGGTGCTGG + Intergenic
928077678 2:28279915-28279937 CTTGGCCTCTCCCAAAGTGCTGG + Intronic
928221330 2:29405674-29405696 CTCTGCCTCTCCCAGTGTGGTGG - Intronic
928434102 2:31242705-31242727 CTCGGCCTATCCCAAAGTGCTGG - Intronic
928510167 2:31995335-31995357 CTCAGCCTCTCCCGAGTAGCTGG - Intronic
928842938 2:35632800-35632822 CTCAGCCCCTCCCAAGTAGCTGG + Intergenic
929150662 2:38745401-38745423 CTCGGCCTCTCCCAAAGTGCTGG - Intronic
929202624 2:39253246-39253268 CTCAGCCTCTCCCGAGTAGCTGG + Intronic
929438515 2:41947632-41947654 CTCGTCCTCTCCCCTAGTGCAGG - Intronic
929578556 2:43067900-43067922 CTGGGCCTCTCCCATGGCGGGGG - Intergenic
929579632 2:43073598-43073620 CTCAGCCTCTCCCTGGCTTCAGG - Intergenic
929705760 2:44210331-44210353 CTCAGCCTCTCCCAAGTAGCTGG + Intronic
929896393 2:45964209-45964231 CTCTGCCTGTCCCCAGGTGCTGG - Intronic
929938578 2:46313288-46313310 CTCAGCCCCACCCATGAGGCTGG + Intronic
931463978 2:62471037-62471059 CTCAGCCTCTCTCCAGATGCAGG + Intergenic
931732743 2:65167417-65167439 CTAAGCCTCCCCCAAAGTGCTGG + Intergenic
932234602 2:70110911-70110933 CTCAGCCTCTCAAAGTGTGCTGG - Intergenic
932932655 2:76061017-76061039 CTCAGCCTCTCCCAAGTAGCTGG + Intergenic
934097475 2:88619837-88619859 CTCAGCCTCTCCCAATTAGCTGG - Intronic
934574955 2:95394167-95394189 CTCTGCCTCTTCCATGATGGAGG - Intergenic
935873844 2:107484817-107484839 CTCAGCCTTTCCCATCCTGAAGG + Intergenic
936405209 2:112196633-112196655 ATCAGACTCTTCCATGATGCTGG - Intergenic
936427899 2:112435400-112435422 CTCAGACTCTCCCCTTGGGCAGG + Intergenic
936450559 2:112630840-112630862 CTCAGCCTCTCCCGAGTAGCTGG - Intergenic
938494746 2:131788881-131788903 CTCAACCTCCCAAATGGTGCTGG + Intergenic
938786968 2:134638800-134638822 TTCAGCATCTCCCGTGGTGAGGG - Intronic
939067649 2:137503908-137503930 CTCAGCCTCCCCCAGGTAGCTGG - Intronic
939069035 2:137517711-137517733 CTCAGCATATCCAATGGTGCTGG + Intronic
939266287 2:139877894-139877916 CTCAGCCTCCCACAAAGTGCTGG - Intergenic
940517735 2:154701519-154701541 CTCAGTCTCTACACTGGTGCAGG + Intronic
942238651 2:173938340-173938362 CTCAGCCTCTCCCGAGTAGCTGG - Intronic
942357415 2:175132969-175132991 CTCAGCCTCTCTCAAGTAGCTGG - Intronic
944577464 2:201103333-201103355 CTTGGCCTCTCCCAAAGTGCTGG + Intergenic
944906678 2:204268971-204268993 ATCAGCCCCTCCCAGGCTGCTGG + Intergenic
945564798 2:211383882-211383904 CTCAGCTTTTCCCAAGGTGTTGG + Exonic
945743912 2:213697400-213697422 TTCAGCCTATCACATTGTGCAGG - Intronic
948764054 2:240210516-240210538 CTCAGGCTGGCCCATAGTGCAGG - Intergenic
948779322 2:240308275-240308297 CTCCGCCTCTCCCTTGCTCCAGG + Intergenic
1169260618 20:4135714-4135736 CTCAGCCTCTCCCAACCTCCAGG + Intronic
1170206346 20:13802739-13802761 CTGAGCATCTACCATGGTCCTGG - Intronic
1170291383 20:14773123-14773145 CACTGCCTCACCCATGCTGCAGG + Intronic
1170554345 20:17503689-17503711 CTCAGCCTCCTCCCTGCTGCAGG + Intronic
1170594793 20:17797017-17797039 CTCATCCTCTTCCATGGTGTTGG - Intergenic
1170862629 20:20122268-20122290 CTCAGCCTCTCCCGAGCAGCTGG + Intronic
1171275879 20:23856067-23856089 CTCTGCCTGTCTCCTGGTGCAGG - Intergenic
1172201883 20:33132477-33132499 CTCAGGTTCCCCCTTGGTGCTGG - Intergenic
1172705628 20:36880343-36880365 CCCAGCCTCCCCCAAAGTGCTGG + Intronic
1172726909 20:37051293-37051315 CTCAGCCTCTCCCAAGTAGCCGG + Intronic
1172962631 20:38809230-38809252 CTCAGCCTGTCTCCTGGGGCGGG + Intronic
1173159891 20:40644556-40644578 CTGAGGCTCTCACCTGGTGCTGG + Intergenic
1173504151 20:43573936-43573958 CTCAGCCACTGCCATGGTGTTGG + Intronic
1174378427 20:50141263-50141285 CTTAGCCTCTCAGATGGTGATGG + Intronic
1174905459 20:54545517-54545539 CTCTTCCTCTGCCATGGTGGTGG - Intronic
1175030370 20:55947448-55947470 CTCAGCCTCTCCCGAGTAGCTGG - Intergenic
1175169545 20:57070426-57070448 CTCAGCCTCTTCCCAGGTGGGGG + Intergenic
1175608222 20:60328764-60328786 CTCAGGCTCTCCCATCCTGCAGG - Intergenic
1175879102 20:62246379-62246401 CTTAGACTCTCCCATGGCACTGG - Intronic
1175992439 20:62796516-62796538 CTCGGCCTCTCCCATGGCCGCGG - Exonic
1176248881 20:64110574-64110596 CTCAGGCTGTCCCAGGGTCCTGG - Intergenic
1176374351 21:6079811-6079833 CTCAGACTCTCCCCTTGGGCAGG - Intergenic
1177575610 21:22950919-22950941 CTCAGCCTCCCCCAAGCAGCTGG - Intergenic
1177725353 21:24959996-24960018 TTCAGCCTTTCCCATTCTGCTGG + Intergenic
1178358332 21:31927290-31927312 CTCAGCCACACCCAAAGTGCTGG + Intronic
1178661264 21:34509704-34509726 CTCGGCCTCTCCCAAAGTGCTGG + Intergenic
1179380464 21:40894606-40894628 CTGAGCATCTGCCATGGTGAAGG - Intergenic
1179478176 21:41661047-41661069 GTCAGCTTCACCCACGGTGCTGG + Intergenic
1179749125 21:43458434-43458456 CTCAGACTCTCCCCTTGGGCAGG + Intergenic
1179915868 21:44477811-44477833 CCAAGCCTCTCCCGTGGTGCAGG - Intergenic
1179915885 21:44477884-44477906 CCAAGCCTCTCCCGTGGTGCAGG - Intergenic
1179941529 21:44641783-44641805 CCCAGCCTCTACCAAGGTGGAGG + Intronic
1180498937 22:15914954-15914976 CTCAACCTCCCAAATGGTGCTGG + Intergenic
1180597573 22:16988627-16988649 CTCAGACTCTCCTGTGGTGTTGG + Intronic
1180824991 22:18855820-18855842 CTCTGCCTCTCTCCTGGTGGTGG - Intronic
1180885496 22:19240490-19240512 CTCAGCCTCCCCCATTGGCCCGG - Intronic
1181125407 22:20698971-20698993 CTCTGCCTCTCTCCTGGTGGTGG - Intergenic
1181187740 22:21118728-21118750 CTCTGCCTCTCTCCTGGTGGTGG + Intergenic
1181211458 22:21291765-21291787 CTCTGCCTCTCTCCTGGTGGTGG - Intergenic
1181398046 22:22635122-22635144 CTCTGCCTCTCTCCTGGTGGTGG + Intergenic
1181510504 22:23386789-23386811 CTAAGCCGCTCCCAGGGTGCGGG - Intergenic
1181651362 22:24260938-24260960 CTCTGCCTCTCTCCTGGTGGTGG - Intergenic
1181706016 22:24649801-24649823 CTCTGCCTCTCTCCTGGTGGTGG + Intergenic
1182232931 22:28852531-28852553 CTCAGCCTCTTCCAAAGTGCTGG - Intergenic
1182712983 22:32334252-32334274 CTCCACCTCTCCCCTGGTGCTGG + Intergenic
1182980352 22:34664973-34664995 CTCAGCCTCCCCCAAGTAGCTGG + Intergenic
1183503720 22:38196691-38196713 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
1183689294 22:39379246-39379268 GTCTGCCTTTCCCAAGGTGCTGG + Intronic
1183959170 22:41400874-41400896 CTCAGCCTCCCCCAAGTAGCTGG + Intergenic
1184400248 22:44269817-44269839 CTCCGCCTCTCCCCTGGTGCTGG + Intronic
1184516619 22:44966212-44966234 CTCTGCCTCTCCCTTTATGCTGG - Intronic
1185219595 22:49622746-49622768 CGCAGCCTCCCCCCTGGGGCAGG + Intronic
1185333117 22:50260487-50260509 CTGGGCCTCTCCCATGGCGGTGG - Intronic
1203215490 22_KI270731v1_random:3666-3688 CTCTGCCTCTCTCCTGGTGGTGG + Intergenic
1203275136 22_KI270734v1_random:81725-81747 CTCTGCCTCTCTCCTGGTGGTGG - Intergenic
949553305 3:5130648-5130670 CTCAGCCTCTCCCCAGTAGCTGG + Intronic
950650233 3:14402586-14402608 CTCAGCATCACCCATCCTGCTGG - Exonic
951210428 3:19968710-19968732 CTCAGCCTCCCACAGTGTGCTGG + Intronic
951507707 3:23466925-23466947 CAGAGCCTCTCCCATTGTGAAGG - Intronic
953199858 3:40769037-40769059 CCCAGGCTTTCCCATGGTACTGG - Intergenic
953874558 3:46659064-46659086 ATCAGCCTCTGCCGAGGTGCAGG + Intergenic
954721934 3:52571769-52571791 CTCAGCCTCCCCGAAAGTGCTGG - Intronic
955151971 3:56376398-56376420 CTCAGCCTCACCCATTGAGAGGG - Intronic
956414092 3:69009101-69009123 CACTTCCTTTCCCATGGTGCTGG - Intronic
956743251 3:72291401-72291423 CCCAGCCTCTCCCACCGTGTTGG - Intergenic
958754769 3:98237808-98237830 CTCAGCTCCTCCCATAGTGCTGG - Intergenic
958891843 3:99792451-99792473 CTCTGGATCTCCCATGCTGCTGG - Intronic
961252928 3:125521858-125521880 CTGGGCCTCTCCCAAAGTGCTGG - Intergenic
961482794 3:127194986-127195008 CTGAGCACCTCCCATGGTCCAGG + Intronic
961662908 3:128479856-128479878 CACAGCCTCTCCCTGGGTCCTGG + Exonic
963326487 3:143868989-143869011 CTCAGCCTCCCCCAAGTAGCTGG + Intergenic
964881984 3:161432945-161432967 GTCAGACCCTCCCATGGTGCTGG + Intergenic
966234609 3:177686768-177686790 CCCAGACACTCCCATGATGCAGG + Intergenic
967073308 3:185980938-185980960 CTCAGCCTCCCCCAAAGTCCTGG - Intergenic
967299534 3:187999103-187999125 CTCTGCATCTCCCATGGGGTGGG - Intergenic
968298218 3:197593481-197593503 CTCAGCCTCCCCCAAGTAGCTGG - Intergenic
968317281 3:197735837-197735859 CTCAGCCTCCCCCAAGGTGCTGG + Intronic
968528158 4:1075154-1075176 CACAGCCCCTCCCATGTGGCAGG - Intronic
969310813 4:6352175-6352197 CTCAGCTTCTGACCTGGTGCTGG - Intronic
969316967 4:6388226-6388248 CTCAGCCAGCCCCCTGGTGCTGG + Intronic
969660039 4:8522009-8522031 CTCAGCTTCTCGCTTGGTGCTGG + Intergenic
970592545 4:17572002-17572024 CTCAGCCTCCCCCAGGTAGCTGG - Intergenic
971077244 4:23164430-23164452 CTCCGCCTCTGCCATGATTCAGG + Intergenic
971290876 4:25338206-25338228 CTCAGTCTCTCCCAAGTAGCTGG + Intronic
972572757 4:40326049-40326071 CTCAGCCTCCCCCATGTAGGAGG + Intergenic
976224228 4:82782498-82782520 CTGTTCCTCTCCCAAGGTGCAGG + Intronic
976873738 4:89828824-89828846 CTCAGCCCCTCCCAAGTAGCTGG - Intronic
977938994 4:102837835-102837857 CTCAGCCTCTCCCGAGTAGCTGG - Intronic
978592106 4:110335284-110335306 CTCAGCCTTCCCCATGTAGCTGG - Intergenic
978743580 4:112166161-112166183 CTCAGCCTCTCCCGAGTAGCTGG + Intronic
980000775 4:127485128-127485150 CTCTGCCACTACCATGGTCCAGG + Intergenic
981389040 4:144166325-144166347 CTCGGCCCCTCCCAAAGTGCTGG - Intergenic
981476754 4:145194825-145194847 CTCAGCCTCCCCCATGTAGATGG - Intergenic
982007669 4:151078942-151078964 CTCAGCCTCCCCCAAGTAGCTGG + Intergenic
982184653 4:152783191-152783213 CTCAGCCCCTCCCAAGTAGCTGG - Intronic
984754811 4:183315133-183315155 CTCAGCCTCTCCGCTGCTTCGGG + Intronic
984853231 4:184171813-184171835 CTCAGCATCTCGAATCGTGCCGG - Intronic
985243113 4:187951647-187951669 CTCAGCCTGTCCCAAGTAGCTGG + Intergenic
985771789 5:1816373-1816395 GTCAGCCTCTCTCCTGTTGCTGG + Exonic
986014485 5:3746216-3746238 CTCAGTCTCTCCCATTCTTCTGG + Intergenic
986048083 5:4060307-4060329 CTCAGGCTCTGCAATGGAGCTGG - Intergenic
986685776 5:10274175-10274197 CTCGGCCTCTCCCATGACACAGG + Intergenic
986689961 5:10306333-10306355 CTCAGGCTCTCCCAGGAGGCTGG - Intronic
987374085 5:17218029-17218051 TTCAGCCGCTCGCATGGTGGAGG + Intronic
989032001 5:37128605-37128627 CTCGGCCCCTCCCAAAGTGCTGG - Intronic
990438302 5:55817580-55817602 CTCAGCCTCTCCCGAGTAGCTGG + Intergenic
991326188 5:65436112-65436134 TTCGGCCTCTCCCAAAGTGCTGG - Intronic
992777040 5:80097719-80097741 CTCAGCCCCTCGCCTGGTGGGGG + Intergenic
994580964 5:101641335-101641357 CTTGGCCTCTCCCAAAGTGCTGG - Intergenic
995750798 5:115451668-115451690 CCCAGCCACTCCCATTGTTCTGG + Intergenic
996124752 5:119711160-119711182 CCCAGCCTCTTCCATGGAGTAGG + Intergenic
997493005 5:134295129-134295151 CTCAGCCTCCCCCAAGTAGCTGG + Intronic
998154452 5:139776440-139776462 CTCAGCCCCTGCCTTGCTGCAGG - Intergenic
998426307 5:142031572-142031594 CTACCCCTCTCCCATGGTTCTGG - Intergenic
999140556 5:149358422-149358444 CTGAGCATCTGCCATGGTCCTGG + Intronic
1000121680 5:158203720-158203742 AGCAGCCTCTCCCATGGAGGTGG + Intergenic
1001108084 5:168872753-168872775 CTCAGCCTCTCCCGAGTAGCTGG + Intronic
1001280346 5:170382078-170382100 GTCAGCATCTCCCCTGCTGCAGG + Intronic
1002433665 5:179218788-179218810 CTCAGCCTCAGCCATGCTTCAGG + Intronic
1003241434 6:4349023-4349045 CTCAGCCTCTCCCGAGTAGCTGG + Intergenic
1003527959 6:6913623-6913645 CTCTTCCTGTCCCAAGGTGCAGG - Intergenic
1004184953 6:13413699-13413721 CACAGGCTGTCCCATGGTCCAGG - Intronic
1004296271 6:14414312-14414334 GTCAGCCTCTCCTAAAGTGCTGG - Intergenic
1004393375 6:15227657-15227679 GTCAGCCTCTCCCTTGCAGCTGG + Intergenic
1004656375 6:17666074-17666096 CTCAGCCTCTCAAAGAGTGCTGG + Intronic
1005266340 6:24116035-24116057 CTCAGCCTCCCCCAAGCAGCTGG - Intergenic
1005567563 6:27112361-27112383 CTAAGCCTCTTCCATGGAGATGG + Intergenic
1005630214 6:27700258-27700280 CTCAGCCTCCCCTAAAGTGCTGG - Intergenic
1005752037 6:28892367-28892389 CTCAGCCTCCCCCAACCTGCAGG - Intergenic
1006319499 6:33312208-33312230 CTCAGCTTCTGCCAGGGTGGGGG + Intronic
1006520557 6:34568706-34568728 CTCAGCCCCTCCTGTGGAGCTGG - Intergenic
1006531628 6:34660048-34660070 CTCTGCGCCTCCCAAGGTGCTGG - Intronic
1006597203 6:35202152-35202174 CTCATCCTCTCCCATACAGCAGG - Intergenic
1006815575 6:36847674-36847696 CTCAGCCTCTGCCATGGCCCAGG + Intergenic
1007370329 6:41422616-41422638 CTCAGCCTGTCCCTGGGGGCTGG - Intergenic
1007642537 6:43353984-43354006 GCCAGCCTCTCCCAGAGTGCTGG - Intronic
1007681579 6:43637314-43637336 CTTGGCCTCTCCCAAAGTGCTGG + Intronic
1008096929 6:47348700-47348722 CTTGGCCTCTCCCAAAGTGCTGG - Intergenic
1009550243 6:65082274-65082296 CTCAACCTCTCTAATGGTGGAGG + Intronic
1011644002 6:89440672-89440694 CTTAGCCTCTCCCAAGTAGCTGG - Intronic
1012145098 6:95670455-95670477 CTCCGCCTGGGCCATGGTGCAGG + Intergenic
1013251654 6:108340477-108340499 CTCAGCCTCTCCCAAGTAGCTGG + Intronic
1013836485 6:114341890-114341912 CTCAGTCTCTCCCAGAGCGCTGG - Intronic
1015504474 6:133968101-133968123 CTCAGCCTCCCCCAAGTAGCTGG + Intronic
1015579375 6:134706880-134706902 CACAGCCTCACCCATGATCCTGG + Intergenic
1016279198 6:142394836-142394858 CTCAGCCCCCCCCAGAGTGCTGG + Intronic
1016732062 6:147437740-147437762 CTCAGCCTCTCCCTTCGTCCAGG + Intergenic
1016932192 6:149422360-149422382 CTCAGCCTCCCGCAAAGTGCTGG + Intergenic
1017042832 6:150321760-150321782 CTCAGCCCCTCCCATGCAGGGGG + Intergenic
1017213375 6:151881294-151881316 CTCAGTGTCTAGCATGGTGCTGG + Intronic
1018100759 6:160437532-160437554 CTGAACCTCTGCCATGCTGCTGG + Intronic
1019168829 6:170117277-170117299 CTCAGCCTCCTCCATTGTACAGG + Intergenic
1019707172 7:2502295-2502317 CCCAGCCTGTCCCCTGGTGGTGG + Intergenic
1020046212 7:5042518-5042540 CTCGGCCTCCCCCAGAGTGCTGG - Intronic
1020110835 7:5446899-5446921 CTCAGCATATCCCAGGGGGCTGG + Intronic
1020134913 7:5581784-5581806 CTCGGCCTCTCCCAAAGTGCTGG - Intergenic
1020291572 7:6726433-6726455 CTCGGCCTCCCCCAGAGTGCTGG - Intergenic
1020566117 7:9797897-9797919 CTCAGCCTCCCCCAAGTAGCTGG + Intergenic
1021621732 7:22555910-22555932 CTCTGCCTCAGCCCTGGTGCAGG + Intronic
1021846892 7:24771876-24771898 CTCAGGCTCTCCAGTGGAGCTGG - Intergenic
1022324187 7:29315700-29315722 CTCAACCTCTCACTTTGTGCTGG + Intronic
1022383342 7:29881080-29881102 CTCAGTCTCTCCCTTCCTGCAGG + Intronic
1022966016 7:35472906-35472928 CTCAGCATCTCTCATGGTGTAGG + Intergenic
1023703293 7:42913175-42913197 CTCTGCCCCTCCCATAATGCAGG + Intronic
1023860221 7:44213932-44213954 CTCAGCCTGCCCACTGGTGCCGG + Exonic
1024927492 7:54632849-54632871 GTCAAAGTCTCCCATGGTGCTGG + Intergenic
1025172009 7:56767509-56767531 CTCAGCCCCTCCCAAGGAGCTGG - Intergenic
1026087456 7:67274251-67274273 CTCTGCCTCCCCCAGAGTGCTGG + Intergenic
1026726779 7:72875986-72876008 CTCAGCCTCCCCCAGAGTGCTGG - Intergenic
1026824340 7:73571944-73571966 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
1027117061 7:75489635-75489657 CTCGGCCTCCCCCAGAGTGCTGG + Intergenic
1027274748 7:76545969-76545991 CTCGGCCTCCCCCAGAGTGCTGG - Intergenic
1028179327 7:87699518-87699540 CTCAGCCTCTCTCAAGTAGCTGG + Intronic
1029356527 7:100056188-100056210 CTCAGCACCTCCCAAAGTGCTGG + Intronic
1029364187 7:100106705-100106727 CTCGGCCTCTCCTCTGGGGCTGG + Exonic
1029461891 7:100699460-100699482 CTCAGCCTTTCCCAAAGTGCTGG - Intergenic
1029656897 7:101931795-101931817 CTCAGTCCCTCCCAAAGTGCTGG + Intronic
1029665000 7:101989394-101989416 CTCAGCCTCTAGCATCCTGCTGG + Intronic
1029686445 7:102151609-102151631 CTTAGCCTCTCCCAAGTAGCTGG - Intronic
1029720442 7:102360427-102360449 CTCGGCCTCCCCCAGAGTGCTGG - Intergenic
1031796891 7:126186189-126186211 CTCAGACTCTCCTTTGGTGGGGG + Intergenic
1031815028 7:126422832-126422854 CTCTGCCTCTCCCATGGGCATGG - Intergenic
1033068101 7:138175583-138175605 CTCAGCCTCCCCCAAGTAGCTGG - Intergenic
1033213622 7:139478787-139478809 CTCTCCCTCTCCCATGGGGATGG + Intronic
1033241268 7:139681890-139681912 GACAGCATCTCCCCTGGTGCTGG + Intronic
1033255659 7:139799344-139799366 CTCAGCCTCCCCCAAGTAGCTGG + Intronic
1033393401 7:140950215-140950237 CTCAGCCTCCCACAAAGTGCTGG - Intergenic
1034091824 7:148370828-148370850 CTCAGCCTTCTCCCTGGTGCCGG + Intronic
1034380675 7:150689387-150689409 CTCATTCTCTCCCATGGGGAGGG - Intronic
1034529110 7:151684352-151684374 CTCAGCTGCTTCCACGGTGCTGG - Intronic
1035051469 7:156001306-156001328 CTCACCGTCTCCCATGGTGCTGG + Intergenic
1035182006 7:157096430-157096452 CACTGCCTCTCCCACGCTGCGGG - Intergenic
1035265141 7:157685970-157685992 CCCGGCCTCTCCCAGGTTGCAGG - Intronic
1035429603 7:158808857-158808879 CTCAGCCCCTCCCAAGTAGCTGG - Intronic
1035724371 8:1815389-1815411 CTGAGCCCCTCCCCAGGTGCAGG - Intergenic
1036206662 8:6810570-6810592 CTCAGCCTCACCCATGCTAAGGG - Exonic
1037499974 8:19476353-19476375 CTCAGCCTCCCCCAAGTAGCTGG + Intronic
1037852437 8:22343151-22343173 CTCGGCCCCTCCCAAAGTGCTGG - Intronic
1040929341 8:52717487-52717509 TTCAGCCTCCCCCACAGTGCTGG + Intronic
1040983079 8:53265940-53265962 CTCAGCTTCTCCCATCCTCCTGG - Intergenic
1042270243 8:66948033-66948055 CTTAGGCTCTCCCCTGGTGGGGG - Exonic
1042416301 8:68523932-68523954 CTCACCCTCTCCACTGGGGCTGG + Intronic
1044012304 8:87009549-87009571 CTCAGCCTCTCAAAGTGTGCTGG + Intronic
1046960106 8:120102468-120102490 CTCAGCCCCTCCAATGCAGCAGG - Intronic
1048315209 8:133356609-133356631 GTCAGCCTCTCCCACAGTCCTGG - Intergenic
1048911657 8:139141121-139141143 CTCTGGCTCTCCCATAGTCCTGG - Intergenic
1049285562 8:141773295-141773317 CCCAGCCTGGGCCATGGTGCTGG + Intergenic
1049310304 8:141930629-141930651 CTCAGCATCTCACAGGGCGCAGG + Intergenic
1050729717 9:8695080-8695102 CTCTGCCTTTCTCATTGTGCTGG + Intronic
1050937134 9:11413282-11413304 CTCACCCCCTTCCATGGTGGAGG + Intergenic
1052401425 9:28005168-28005190 CTCAGCCAGTCACATCGTGCAGG - Intronic
1052567483 9:30174948-30174970 CTCAGTGTCTCCCATGTAGCTGG - Intergenic
1053381024 9:37650249-37650271 CTCACCCACTCCCCTGGTTCTGG - Intronic
1053480255 9:38411478-38411500 CTCAGCCTCTCCCACCATGTTGG + Exonic
1055038907 9:71847696-71847718 CTTGGCCTCTCCCAAAGTGCTGG - Intergenic
1055052250 9:71992488-71992510 TTCAGGCTCTACCAGGGTGCAGG - Intergenic
1055429785 9:76231766-76231788 CTCATTCTATGCCATGGTGCAGG + Intronic
1055514628 9:77022779-77022801 TTCAGTCTCTACCATGGTGGTGG - Intergenic
1056334839 9:85557891-85557913 CTCAGTCTCTCTCATAATGCTGG + Intronic
1056378976 9:86040434-86040456 CTTAACCCCTCCCATGGGGCTGG + Intronic
1056400733 9:86224822-86224844 CTCAGCCTCTCCCATGTAGCTGG - Intronic
1056441546 9:86627054-86627076 CTCAGCATTTGCCCTGGTGCTGG - Intergenic
1056565322 9:87766935-87766957 CTCAGCCTCCCCCATCCTCCAGG - Intergenic
1056649496 9:88445788-88445810 CTTGGCCTCTCCCAAAGTGCTGG + Intronic
1056705384 9:88948144-88948166 CTAACCCTGTCCCATGGGGCAGG + Intergenic
1056811875 9:89771364-89771386 CACACCCTTTCCCATGGTACTGG - Intergenic
1057045865 9:91885988-91886010 CTCAGCCTCTCCCGAGTAGCTGG + Intronic
1057618152 9:96611919-96611941 CTCAGGCTCTCCCATGGTAGAGG + Intronic
1058215618 9:102230017-102230039 CCCAGCCTCTCCCATGTATCTGG + Intergenic
1058221570 9:102309943-102309965 CTCTGCCTCTCCCAGTCTGCTGG + Intergenic
1058728186 9:107823689-107823711 CTCAGGCTCTCCGATGGTAAAGG - Intergenic
1058945702 9:109853995-109854017 CTCAGCCAAGCACATGGTGCTGG + Intronic
1058959680 9:109980715-109980737 CTCAAGCTGTCCCATGGTGATGG + Intronic
1058966647 9:110045099-110045121 CTTTGCCTCTCCCATGCTGCTGG - Intronic
1059254642 9:112918535-112918557 CTCAGCCTCATCCCTGGGGCAGG - Intergenic
1059650356 9:116310444-116310466 TTCAGCCTGTCCCATGGTGTGGG + Intronic
1059680650 9:116582152-116582174 CTCTGCCTCTAACATGCTGCAGG + Intronic
1061067136 9:128285573-128285595 CTCAGTCTCTGCCATGTGGCTGG - Intronic
1061147083 9:128806333-128806355 CTCAGCCACTGCCATGAGGCTGG + Intronic
1061329658 9:129884633-129884655 TGCAGCCTCCCCCACGGTGCAGG - Intergenic
1061686655 9:132285931-132285953 CTCAGCCTCCCTCAAAGTGCTGG - Intronic
1061742115 9:132714858-132714880 CTCAGCCTCTCCCGAGTAGCTGG - Intergenic
1061848145 9:133399624-133399646 CTCAGCCCCTCCCAAAGTGCTGG - Intronic
1062383750 9:136300013-136300035 CTCTGCCTCTCCAGTGGGGCAGG - Intronic
1062623225 9:137431781-137431803 CTCCGCCTCTCCCCAGGTGCCGG - Intronic
1062647246 9:137554689-137554711 CTCAGCCCCTTCCAAAGTGCTGG + Intergenic
1185563484 X:1078738-1078760 CTCAGCCTCTCCCAAGTAGCTGG + Intergenic
1185612397 X:1400650-1400672 CTCAGCCTCCCCCCTGTAGCTGG + Intergenic
1185686121 X:1930061-1930083 CTCAGCCTCCCCCAAAGTGCTGG - Intergenic
1185852436 X:3501659-3501681 CTGGGCCTCTCCCATGGTTCTGG + Intergenic
1186023146 X:5279586-5279608 CTCAGCCTCTCCCGAGTAGCTGG - Intergenic
1186939171 X:14485930-14485952 CACATCCTGTCCCATGGGGCAGG - Intergenic
1186970777 X:14840104-14840126 CTCAGCCTCCCCCAGAGTGCTGG + Intergenic
1187688629 X:21841167-21841189 CTCAGCCTCCCCCAAAGTGCTGG - Intronic
1188078640 X:25808618-25808640 CTCAGTCACTGCCATGGGGCTGG + Intergenic
1191780409 X:64858150-64858172 CTCAGCCTCTTTCATGGTCTAGG + Intergenic
1192510258 X:71717098-71717120 CTCAGCCGCTCCCCCGGAGCCGG - Exonic
1192516439 X:71764455-71764477 CTCAGCCGCTCCCCCGGAGCCGG + Exonic
1192639236 X:72846967-72846989 CTCCGCCCCTCCCAGGGTTCTGG - Intronic
1192642475 X:72873838-72873860 CTCCGCCCCTCCCAGGGTTCTGG + Intronic
1194507190 X:94746735-94746757 CTCAGTCCCTCCCATGATGTGGG - Intergenic
1199982639 X:152929264-152929286 CTCAGCCTCTGCCCTGGGGTGGG + Intronic