ID: 1138297467

View in Genome Browser
Species Human (GRCh38)
Location 16:55899287-55899309
Sequence CTCATTGCCATTATAATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138297464_1138297467 14 Left 1138297464 16:55899250-55899272 CCTTTCAGGATAGATACAGGAGT 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1138297467 16:55899287-55899309 CTCATTGCCATTATAATGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 98
1138297463_1138297467 15 Left 1138297463 16:55899249-55899271 CCCTTTCAGGATAGATACAGGAG 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1138297467 16:55899287-55899309 CTCATTGCCATTATAATGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138297467 Original CRISPR CTCATTGCCATTATAATGGG AGG Intronic
903763884 1:25719737-25719759 ATTATTGCCATTCTAGTGGGTGG + Intronic
906630713 1:47365176-47365198 CTAATTGCCACATTAATGGGAGG + Intronic
908871078 1:68613244-68613266 CTCATTTCCATTGTTATTGGTGG + Intergenic
912172446 1:107117032-107117054 CTCATTGCCAGGATAATGGCAGG - Intergenic
918210773 1:182349187-182349209 CTCTTTGCCATTCCAGTGGGAGG - Intergenic
921595691 1:217051512-217051534 ATCATTGCCCTTTTAATTGGAGG - Intronic
921680841 1:218029055-218029077 ATCATTGTCAATATAATGAGAGG + Intergenic
923336404 1:232974796-232974818 ATTAATGCCATTATAGTGGGAGG - Intronic
1070396567 10:76016310-76016332 CTCATTGCCCTTACATTGGGTGG + Intronic
1073751194 10:106528596-106528618 CTCAATGCAACTCTAATGGGAGG + Intergenic
1073826055 10:107322811-107322833 CTTATTGCCATTATATTAGCTGG - Intergenic
1076210191 10:128634398-128634420 CTCAATGCCATGAGACTGGGTGG - Intergenic
1077558824 11:3242931-3242953 GTCATTGCCATGAAAAGGGGTGG - Intergenic
1084913116 11:72407345-72407367 ATCACTGCCAGTCTAATGGGTGG + Intronic
1085071169 11:73547299-73547321 CTCATATCCATTATGATGGCAGG + Intronic
1085980158 11:81715068-81715090 CTCATTGCCATCATACAGGCTGG + Intergenic
1087763132 11:102123105-102123127 ATTATAGTCATTATAATGGGAGG - Intronic
1088608447 11:111553903-111553925 CTCATTGCCAATACAACAGGTGG + Intronic
1088723870 11:112617862-112617884 CACCTTTCCATTCTAATGGGGGG + Intergenic
1091086206 11:132724300-132724322 CTCATTTCCATTATACCTGGGGG - Intronic
1091835109 12:3580133-3580155 ATTGTTGCCATTATAATGTGCGG + Intronic
1099670059 12:85680126-85680148 ATCTTAGCCATTCTAATGGGTGG + Intergenic
1100573716 12:95868910-95868932 CTCATTGTCTTTACAATGTGGGG + Intronic
1104178443 12:126354798-126354820 CTCATTGGCATTCTAACTGGTGG - Intergenic
1111430731 13:88145703-88145725 CTCATTGCCATGGAAAGGGGTGG + Intergenic
1113209202 13:107955448-107955470 GTCATTGCCATGGTAAGGGGTGG - Intergenic
1113282182 13:108800314-108800336 CTCTTTGCCATAAAATTGGGAGG + Intronic
1116558043 14:46338118-46338140 GTCATTGCCATTGAAAGGGGTGG - Intergenic
1116669161 14:47818414-47818436 TTCATTGCCATTGTAAAGGAAGG + Intergenic
1123124543 14:105937125-105937147 CTGATTGTCATTACAATTGGAGG - Intergenic
1124924850 15:34061050-34061072 CACCTTGACATGATAATGGGCGG - Intronic
1126250693 15:46565089-46565111 CTCAGTGCAGTTATAATGGTGGG - Intergenic
1128195607 15:65752107-65752129 CTCATTGCTTTTGTAGTGGGCGG + Intronic
1130036688 15:80367556-80367578 CTAATTACCATTCTAATTGGAGG - Intronic
1132539494 16:501882-501904 CTCCTTGCCTATAAAATGGGGGG - Intronic
1134179133 16:12033420-12033442 ATAATTGCCATCCTAATGGGTGG + Intronic
1138239304 16:55413959-55413981 GTCATTCCCATAAAAATGGGAGG - Intronic
1138297467 16:55899287-55899309 CTCATTGCCATTATAATGGGAGG + Intronic
1138814312 16:60186750-60186772 GTCATTGCCATGAAAAGGGGTGG - Intergenic
1140581364 16:76234965-76234987 CACATTGACATTACAGTGGGGGG - Intergenic
1142195262 16:88736631-88736653 CTCATTGCCATGATGGTAGGCGG - Exonic
1145816856 17:27801188-27801210 ATCATTTCCATTATAAGGGAAGG - Intronic
1148931131 17:51128233-51128255 GTCATTGCCATGGAAATGGGTGG + Intergenic
1155585048 18:27355231-27355253 ATCATTGCCATTATCATTGATGG + Intergenic
1166513329 19:43426137-43426159 ATCATTGCCATAGAAATGGGTGG - Intergenic
927675355 2:25101652-25101674 AACATTGCCATTAAAATGAGGGG - Intronic
931298858 2:60957377-60957399 CTCATAGCATTTATGATGGGTGG + Intronic
931965421 2:67528569-67528591 CTCATTGCCATGATGCTGGTGGG - Intergenic
932866664 2:75350513-75350535 GTCATTGCCCTTCTAATGGCAGG + Intergenic
934049167 2:88195839-88195861 CTCAGTGCCATTTTAATGCTAGG + Intergenic
936528374 2:113257782-113257804 ATCATAGCCAGTATTATGGGAGG + Intronic
937511234 2:122597533-122597555 CTCACTGCCATTATAGTTGAAGG + Intergenic
938868426 2:135449237-135449259 CTCATTGCAATTGTATTGGATGG - Intronic
940656880 2:156497983-156498005 CACATTCCCAACATAATGGGAGG + Intronic
942993167 2:182227631-182227653 CTCATTGCCATTCTATAAGGTGG + Intronic
943292379 2:186090632-186090654 TTAATTGCCATTAAAATGGTAGG + Intergenic
945008614 2:205437615-205437637 CTAATGGCCATTATATTGGACGG + Intronic
945809710 2:214533934-214533956 GTCATTGCCAATAAAATGGATGG + Intronic
948200404 2:236125862-236125884 CTCATTGACAGTGTGATGGGGGG + Exonic
1175385419 20:58591885-58591907 CTCAATGCCATGACAATGTGAGG + Intergenic
1185242902 22:49755912-49755934 GTCATTGCCATGAAAAGGGGTGG - Intergenic
950350767 3:12349635-12349657 TTCATTGCCAATATAATATGTGG - Intronic
951191849 3:19781090-19781112 CTCTATTTCATTATAATGGGAGG - Intergenic
951633184 3:24743505-24743527 CTTATTGCCATCATAATGGTGGG + Intergenic
953208864 3:40856732-40856754 CTCATTTTCATTAAAAAGGGTGG - Intergenic
953663161 3:44905755-44905777 GGCATTGCCCTTATAATAGGGGG + Intronic
958526058 3:95261215-95261237 CTCATTGCCTTTATTAAAGGTGG + Intergenic
966759970 3:183408939-183408961 CACCTTGCCATGATAATGGGAGG + Intronic
968901469 4:3433905-3433927 CTCAGGGCCATTAGACTGGGTGG - Intronic
972413003 4:38811546-38811568 GTCATTGCCATGAAAAGGGGTGG - Intronic
973707721 4:53596782-53596804 GTCATTGTCATTATAATAGGGGG - Intronic
977583075 4:98746086-98746108 CTCATTGGAAATATAATGAGAGG - Intergenic
979357829 4:119726265-119726287 CTCATCACCATTATTATTGGGGG - Intergenic
981005969 4:139875567-139875589 CTCATTGACATGTTAATAGGGGG + Intronic
981238257 4:142443439-142443461 CTCATTGAAATTAGAAAGGGAGG + Intronic
982993515 4:162311155-162311177 CTCATTGCCATTCAAATGTTAGG - Intergenic
987455149 5:18134958-18134980 CTCATTGCCTTCATACTGAGTGG - Intergenic
993025295 5:82638314-82638336 CTCCTTTTCATTATAGTGGGAGG + Intergenic
994867779 5:105299709-105299731 CTCAATGGCATTATGCTGGGTGG + Intergenic
998183532 5:139961902-139961924 CTCAATCCCAGTATAATGTGGGG + Intronic
1004370492 6:15048110-15048132 CGCTTTGCCATTTTGATGGGAGG - Intergenic
1004840415 6:19577528-19577550 GTCATTGCCATGAAAAGGGGTGG + Intergenic
1005137703 6:22589888-22589910 CTCTTTACAATTATAATAGGAGG - Intergenic
1006006677 6:31008130-31008152 CTCTTCGCCATTATAAAAGGAGG - Intergenic
1008029490 6:46677853-46677875 CTCACTGCCATTTTAAGAGGGGG + Exonic
1011686171 6:89825539-89825561 ATTATTGCCCTTATAATGGGAGG + Intergenic
1014713031 6:124831404-124831426 CTCATTGCCAATATAGTTGCAGG + Intergenic
1018276984 6:162143416-162143438 CTCATTGCCCTTATAGTGCATGG - Intronic
1025140976 7:56464352-56464374 CTCAGTGACATTATAATTTGAGG - Intergenic
1029350193 7:100007974-100007996 CTCATTGCCATGGAAAGGGGTGG + Intergenic
1030536196 7:110770323-110770345 ATGAGTGCCATTATATTGGGGGG - Intronic
1036062289 8:5337256-5337278 CTCACTACAATTATAATTGGGGG - Intergenic
1037783401 8:21886690-21886712 CCCATTGTCCTTATAATGAGAGG + Intergenic
1039258847 8:35748862-35748884 CTCTTTTCTATTATAATGGGGGG - Intronic
1043287134 8:78546904-78546926 CTCATTCACATTATAATGCTTGG - Intronic
1043598623 8:81914206-81914228 ATCATTGCTATTATTATGGTAGG + Intergenic
1044051425 8:87510525-87510547 CTCATAGCCATTAAAATAGGTGG + Intronic
1045321951 8:101088643-101088665 ATCTTTGCCATTCTGATGGGTGG - Intergenic
1047483818 8:125310002-125310024 CTCATTTCTACTATGATGGGGGG + Intronic
1057715172 9:97488017-97488039 TTGATTGTCATTAAAATGGGAGG + Intronic
1060431655 9:123555963-123555985 TTCATTCCCATTTTAAAGGGGGG + Intronic
1061305713 9:129731953-129731975 GTCATTGCCATGGAAATGGGGGG - Intergenic
1188820294 X:34766799-34766821 CCCATTTCCTATATAATGGGAGG + Intergenic
1190914986 X:54804787-54804809 CTCATGGCCTTTATTCTGGGAGG + Intergenic
1195343376 X:103926131-103926153 CTCATGGCCAGTACACTGGGAGG - Intronic
1195363624 X:104107339-104107361 CTCATAGCCAGTACACTGGGAGG + Intronic
1195365151 X:104117442-104117464 CTCATGGCCAGTAGACTGGGAGG + Intronic