ID: 1138299266

View in Genome Browser
Species Human (GRCh38)
Location 16:55912630-55912652
Sequence CAGGGAAAAGACCAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 797
Summary {0: 1, 1: 0, 2: 8, 3: 77, 4: 711}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138299266 Original CRISPR CAGGGAAAAGACCAGGAGGA GGG Intronic
900613688 1:3554955-3554977 CAGGGAAAAGACAGGGCGGCTGG + Intronic
900751864 1:4402948-4402970 CAGGGACAAGACAAGCAGGGTGG + Intergenic
900912945 1:5615023-5615045 CAGGGAATATAGCAGGATGAAGG + Intergenic
900927456 1:5714533-5714555 CAGGGAAAAGACCAGGCCTTTGG + Intergenic
900971308 1:5993631-5993653 CAGGACAAATGCCAGGAGGAGGG - Intronic
901036417 1:6338764-6338786 CAGGGAGAGGACCAGGGGCAGGG + Intronic
901052775 1:6433794-6433816 CTGGGCAAAGACTTGGAGGAAGG - Intronic
901922623 1:12547853-12547875 CAGGGCAAATGCCAGGTGGATGG - Intergenic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902447055 1:16474205-16474227 CAGGGAAAAGGCCCTGAGGCGGG + Intergenic
902919062 1:19655880-19655902 CAGGGAAAAGAACAGGTGCAAGG - Intronic
903538058 1:24080425-24080447 CAGGGAAGCTACCGGGAGGAGGG - Intronic
903728563 1:25471644-25471666 CAGGGAAAATACTAGGAAGCAGG + Intronic
904357151 1:29947734-29947756 CAAGGAAAAGAAGAGGAGGAAGG - Intergenic
904376832 1:30086840-30086862 CAGGGGAAAGACGATGAGAAGGG + Intergenic
904439255 1:30519205-30519227 GATGGAAAAGATGAGGAGGATGG + Intergenic
905121867 1:35688666-35688688 CAGGGAATAGACCTGGTTGAAGG + Intergenic
905442004 1:38001593-38001615 CAGGGAAAAGGGCAGGGAGAGGG - Intronic
905543062 1:38775467-38775489 TAGGGTAAAGAAGAGGAGGAAGG - Intergenic
905898309 1:41563439-41563461 CAGGAAAAAGTCAGGGAGGAGGG - Intronic
905915859 1:41683874-41683896 CAGTGATAGGACCAGGAGGGTGG - Intronic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906191983 1:43904794-43904816 CAGGAAGAGGAACAGGAGGAGGG - Intronic
906191991 1:43904827-43904849 CAGGAATAGGAGCAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906472097 1:46139671-46139693 AAGAGGAAAGACGAGGAGGATGG - Intronic
906520147 1:46461971-46461993 TAGGGAGGAGACCAGGAGGGAGG - Intergenic
906962918 1:50430347-50430369 CCCGGAAATGACCAGGAGGAGGG + Intergenic
907048363 1:51313663-51313685 CTGGGCAAAGGCCTGGAGGAGGG - Intronic
907099057 1:51811176-51811198 CAGGGAAAGGTAAAGGAGGAAGG - Intronic
907133422 1:52117471-52117493 CAGGGAAAAAACCAGAGGGATGG + Intergenic
907520154 1:55018561-55018583 CAGGGCTATGACAAGGAGGAAGG + Intergenic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
909349182 1:74629602-74629624 CAGGAAAATGACCAGGAGAATGG - Intronic
909480545 1:76125269-76125291 CAGGGAACAGGTAAGGAGGAGGG - Intronic
909906660 1:81204319-81204341 TATGGCAAAGACCCGGAGGAGGG - Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910131901 1:83917367-83917389 CAGTGAAAAGACCATGAGTCAGG - Intronic
910144152 1:84058844-84058866 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
910214191 1:84825758-84825780 CAGAGAAAGGCCCAGGAGGCCGG + Intronic
910551628 1:88481857-88481879 TAAGGAAAAGACCAGGTGGCTGG - Intergenic
910678298 1:89837199-89837221 GAATGAAAAGGCCAGGAGGAAGG - Intronic
910708052 1:90150642-90150664 TAGGGAAAAGGCTAGGAGGTGGG - Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911646068 1:100338211-100338233 CAGGGAAAAGACCTGGAAAGGGG + Intergenic
912021799 1:105115230-105115252 CAGTGAAAAGGCCAGCAGGTCGG - Intergenic
912144821 1:106780575-106780597 CAAGAAAAAGACCTTGAGGAAGG + Intergenic
912284672 1:108356484-108356506 CAGGGAAATGACCATAATGAAGG - Intergenic
913023209 1:114808086-114808108 CAGGGAGAAGACCATGAAAATGG - Intergenic
913242278 1:116839411-116839433 CAGTCAAAAGACCAGGAGGATGG + Intergenic
913288161 1:117246603-117246625 CAGGAAAAAGGTCAGAAGGATGG - Intergenic
913477062 1:119248084-119248106 CACTGAAAAGTGCAGGAGGAGGG - Intergenic
913522331 1:119656771-119656793 CAGAGAAAAGACGAGTAGGTGGG - Intergenic
914449257 1:147776081-147776103 CAGAGAAAAGGACAGGACGAGGG + Intergenic
915252346 1:154599650-154599672 CAGGGAAAGAGCCAGTAGGATGG - Intronic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915920312 1:159971467-159971489 CAGGGAGAAGTCCAGGGTGAAGG + Intergenic
916382210 1:164224530-164224552 CAGGGGGAAGGGCAGGAGGAAGG + Intergenic
916908266 1:169313690-169313712 CAGGGAAAAGGCCAACATGAGGG + Intronic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917931331 1:179824660-179824682 CAAGGCAAAGCCCAGGAGGGCGG - Intergenic
918146290 1:181758810-181758832 CAGGGAAAACACCATGGTGAAGG - Exonic
918257351 1:182761340-182761362 CAGAGAGAAGACCAGAAAGAGGG + Intergenic
918546210 1:185687452-185687474 GAGAGAAAAGAAAAGGAGGAAGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
918776051 1:188631898-188631920 CAGTGAAAAGGCCATGAAGAAGG + Intergenic
919604936 1:199669969-199669991 CAGGGACAAGAACCAGAGGAAGG + Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920398333 1:205662065-205662087 CAGAGAGAAGACCAGGGAGATGG + Exonic
920551636 1:206866418-206866440 CAGAGACAAGACCAGGGTGATGG - Intronic
920574638 1:207050644-207050666 CAGGGAAAGTCCCGGGAGGATGG - Intronic
920704254 1:208240283-208240305 GAGGGCTAAGCCCAGGAGGACGG + Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920819752 1:209369374-209369396 CAGGAAAATGGCCAGGAGGGTGG + Intergenic
920860121 1:209699094-209699116 GAGGGAGGAGAACAGGAGGAAGG + Intronic
920915899 1:210257764-210257786 CAGGGAAAATACTGGCAGGAAGG + Intergenic
920919736 1:210288667-210288689 CAGGGAAGGGTCCAGGAGGAGGG - Intergenic
920948946 1:210554913-210554935 AAGAGAAAACACCAGCAGGATGG - Intronic
921599110 1:217088755-217088777 AAGGGAAAAGAAAGGGAGGAGGG + Intronic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
922118214 1:222635060-222635082 CAGGAGAAAGACCACCAGGATGG + Intronic
922154365 1:223029628-223029650 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
922213263 1:223501200-223501222 GAGGGAAAGGAAAAGGAGGAGGG - Intergenic
922824854 1:228510633-228510655 CAGGTGACAGACCAGCAGGATGG - Intergenic
923186175 1:231575740-231575762 CAGGAGAAAGACCAAGAGTATGG - Intronic
923540104 1:234882653-234882675 CAGTGAAGTGACCACGAGGAAGG - Intergenic
924350001 1:243105707-243105729 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1062835152 10:630695-630717 CAGGAAACAGACCAGGTGGCAGG + Intronic
1063132664 10:3192125-3192147 CAGGGAGTAAACCAGGAGCAGGG + Intergenic
1063842282 10:10085981-10086003 CGGGGAAAAGGGCAGGAGGGAGG - Intergenic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1066275617 10:33865639-33865661 CAGGGAAAAGAAAGGAAGGAAGG - Intergenic
1066518846 10:36194046-36194068 CAGGGAAAAGGCAATGAGAAAGG - Intergenic
1066784423 10:38987439-38987461 CAGGGGAAAGGCTGGGAGGAGGG - Intergenic
1067837883 10:49652791-49652813 CAGGGCAAAGGTCAGGAGGCAGG - Intronic
1068241381 10:54305892-54305914 CAGAAAAAAGACCAGGAAGCAGG + Intronic
1068634807 10:59337020-59337042 TAGAGAAAATTCCAGGAGGAGGG - Intronic
1069540066 10:69287374-69287396 CAAGGGAGAGACCAGGTGGAAGG - Intronic
1069597909 10:69684509-69684531 CAGGGGTAAGCCCAGGAGGCAGG + Intergenic
1069718901 10:70537936-70537958 CTGGGAGAGGCCCAGGAGGAGGG - Intronic
1070284959 10:75076162-75076184 CTGGGAAAAGAATAGTAGGATGG + Intergenic
1070645856 10:78202022-78202044 CAGAGAAAAGAGCTGAAGGACGG + Intergenic
1070676195 10:78413225-78413247 CAGGGAATAGGGCAGGGGGAAGG + Intergenic
1070774649 10:79102616-79102638 CAGGGAAGGGACCAGGATTAGGG - Intronic
1071388925 10:85150379-85150401 TAGGAAAAAGAGGAGGAGGAAGG - Intergenic
1072100699 10:92226798-92226820 CAGGGAGGAGACCTGCAGGAGGG + Intronic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072443361 10:95477123-95477145 AAGGGAAAAGAGGAGGAGGTCGG - Intronic
1072543267 10:96414451-96414473 CAGGGAGAAGACAGTGAGGAGGG - Intronic
1072709666 10:97707722-97707744 CTGGGAACAGGCCAAGAGGAGGG + Intergenic
1072805163 10:98419384-98419406 AAGGGAAAAGACAGAGAGGAGGG + Intronic
1073045953 10:100638212-100638234 CTGGGAAAGGAGCAGAAGGAGGG + Intergenic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073359659 10:102887849-102887871 CTGGAAAAAGAAGAGGAGGAAGG - Intronic
1073511896 10:104047719-104047741 CAGGTAACAGAGCAGGAAGAGGG - Exonic
1073703244 10:105954154-105954176 CAAAGGAAAGAACAGGAGGAAGG + Intergenic
1073734891 10:106334704-106334726 CAAGGAAAACAACAGCAGGAAGG + Intergenic
1074612285 10:115033847-115033869 CAGAGAAAATTCGAGGAGGAGGG - Intergenic
1074667854 10:115751920-115751942 GACTGAAAAGACCAGGATGAAGG + Intronic
1074683381 10:115933854-115933876 AAGGGAGAAGACCCAGAGGAGGG - Intronic
1074722511 10:116274483-116274505 CGGGGAGAAGAAGAGGAGGAAGG + Intergenic
1074724785 10:116296810-116296832 GAAGGAAAAGGCCAGGAGGAAGG - Intergenic
1074952418 10:118351140-118351162 CTGGGAAAAGCACAGGAAGAAGG - Intergenic
1075050295 10:119178542-119178564 CGGGGAAGAGACCGCGAGGATGG + Intronic
1075248435 10:120845451-120845473 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1075417488 10:122275704-122275726 CAAGGAAAAAAGCACGAGGAGGG - Intronic
1076114608 10:127886585-127886607 GAGAGAAAAGGGCAGGAGGAGGG + Intronic
1076181509 10:128412587-128412609 CAGGGAAAAGCCAGGGAGGGTGG - Intergenic
1076370671 10:129951100-129951122 TAGGAGACAGACCAGGAGGACGG - Intronic
1076457556 10:130611280-130611302 CAGGGAGAAGAAGAGGAGGGAGG + Intergenic
1076464448 10:130668930-130668952 CAGGGAGACAGCCAGGAGGAGGG - Intergenic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077226047 11:1439583-1439605 CAGGAAAGAGCCCAGGAGGTGGG + Intronic
1077795628 11:5488846-5488868 CATGGCAATGACCAGGATGAGGG - Exonic
1077971570 11:7197802-7197824 CATGCAAAAGCCCTGGAGGAAGG - Intergenic
1078987346 11:16608409-16608431 CAGGGAGAAGACAAGAAGGGTGG + Intronic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079744520 11:24107686-24107708 CAAGGGAAAGACCAGGTGGGAGG + Intergenic
1079759558 11:24311174-24311196 CAAGGGAAGGACCAGGAGGGAGG + Intergenic
1080159778 11:29159912-29159934 AAGAGAAAAGAGGAGGAGGATGG + Intergenic
1080246951 11:30189980-30190002 GAGGGTAGAGATCAGGAGGAGGG - Intergenic
1081305645 11:41508755-41508777 CAGGGAGAAGAGCACGAGAAAGG + Intergenic
1081458518 11:43249199-43249221 CAGGGAAGCCTCCAGGAGGAGGG + Intergenic
1081460002 11:43263791-43263813 CAGGGAGAAGCTGAGGAGGATGG - Intergenic
1081598316 11:44474560-44474582 CAGGATTAGGACCAGGAGGATGG + Intergenic
1082811739 11:57482720-57482742 CTGGGAAAAGACGGGGAGGGGGG + Intergenic
1083198690 11:61106376-61106398 CAGGGCAAAGGCAAGGGGGAAGG + Intronic
1083331188 11:61899107-61899129 CAGGAGAAAGACCAGCCGGACGG + Intronic
1083336644 11:61925691-61925713 CAGGTAAAAGGCCTGGAGGTGGG + Intergenic
1083425254 11:62581058-62581080 CTGGGAAAAGTCCATGAGAATGG - Intronic
1083511096 11:63209989-63210011 ATGGGAAAAAAGCAGGAGGAAGG + Intronic
1083613029 11:64013436-64013458 CAGGGCAAAGGCCCGGAGGCAGG + Intronic
1083670194 11:64295675-64295697 CAGGGAGAAGACTAGGGGAAGGG + Intronic
1083759188 11:64806519-64806541 CAGGGAGGAGACCAGGTAGAAGG - Intronic
1083887495 11:65580050-65580072 CAGGGGAGAGACCAGGAGAAGGG - Intronic
1084014200 11:66369139-66369161 CAGGGCAAAGAGCAGCAGTATGG + Exonic
1084463784 11:69310514-69310536 GTGGGAAAAGACTAGGAGGACGG + Intronic
1084512551 11:69615383-69615405 CAGGCAAGAGACTATGAGGATGG + Intergenic
1085801433 11:79593644-79593666 CAGGGAAGGGTCAAGGAGGAAGG - Intergenic
1086469641 11:87094514-87094536 CAGAGGAAAGACTAGGCGGAGGG - Intronic
1087034027 11:93738232-93738254 CACGGGGAAGACCAGAAGGAAGG - Exonic
1087053393 11:93908289-93908311 GAGGGAGAAGATCAGGAGGCTGG + Intergenic
1087196594 11:95309940-95309962 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1088028690 11:105219524-105219546 CGAGGAAAATACCAAGAGGATGG + Intergenic
1089003121 11:115068580-115068602 CCAAGAAAAGACCTGGAGGAGGG + Intergenic
1089300705 11:117497162-117497184 GAGGGAAAGGGACAGGAGGATGG + Intronic
1089364637 11:117914027-117914049 CTGGGAAAAGTCCAGGAACATGG + Intronic
1089445068 11:118545433-118545455 GAGGGAAAAGAGCAGATGGAGGG + Exonic
1089495007 11:118903327-118903349 CAGGCCGAAGGCCAGGAGGAGGG + Exonic
1089569241 11:119392137-119392159 CAGGGAAAAGGGTGGGAGGAAGG - Intergenic
1089606804 11:119646035-119646057 CAAGGAAAAGGCCAGGAGGCAGG - Intronic
1089908876 11:122075397-122075419 CAGAGATAAGGCCAGGGGGAGGG + Intergenic
1090132533 11:124159705-124159727 GAGGGAAATGAAGAGGAGGAGGG - Intergenic
1090471469 11:126984848-126984870 CAGGGAGGAGACCTGGAGGAGGG + Intronic
1090529377 11:127574839-127574861 CAGGGAAAAGACCAGAAAGACGG + Intergenic
1090716814 11:129438442-129438464 CAGGCAAAAGAAGAGGAAGAAGG - Intronic
1091284942 11:134403291-134403313 CAGGGATGAGAGCAGGAGGCTGG + Intronic
1091386062 12:95570-95592 CAGGGAAAAAACATGGAGGTAGG - Intronic
1091842300 12:3629835-3629857 CAAGGAAAAGACAAGGGGGGGGG + Intronic
1092227350 12:6756434-6756456 GAGGGAAAAGACAAGAGGGATGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092714368 12:11373293-11373315 AAGAGAAATGAGCAGGAGGAAGG + Intronic
1093209373 12:16289340-16289362 AAGGGAACAGACCAGGAGAAAGG + Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093584787 12:20822113-20822135 CGGAGCAAAGAGCAGGAGGACGG + Intronic
1095314685 12:40745676-40745698 CAGGGAAAAGGCCTGGAAAAGGG + Intronic
1095657655 12:44689183-44689205 CATGGAAAAGGCCCAGAGGATGG - Intronic
1096587976 12:52636127-52636149 CAGGGGAAAGAAGAGAAGGAGGG - Intergenic
1096837194 12:54358436-54358458 AATGGGAAAGACCAGGAGGAAGG - Intergenic
1096852553 12:54450589-54450611 TAGGGAAGAGGCCAGGATGAGGG - Intergenic
1097333105 12:58353796-58353818 CAGGAAAAAGACGATGAGAAAGG + Intergenic
1097398248 12:59102127-59102149 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1097476015 12:60057394-60057416 CAGGGGAGAGACCTGGTGGAAGG + Intergenic
1097698750 12:62799658-62799680 CAATGAAAATACCAGGAGGCTGG - Intronic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099111258 12:78564459-78564481 CAGGGCAAACACCAGGAGAGTGG + Intergenic
1099237775 12:80102606-80102628 AAGGGAAGAGACCATCAGGAAGG - Intergenic
1100194307 12:92226949-92226971 CAGGGACAACACCAGGGAGATGG - Intergenic
1100423082 12:94456718-94456740 CAGGGAAGAGACCAGGTGGAGGG - Intronic
1100804521 12:98267579-98267601 GAGGGAAAAGAGCAAGAGAAAGG + Intergenic
1101177877 12:102174967-102174989 GAGGGAAGAGACAGGGAGGAAGG - Intronic
1101565616 12:105902186-105902208 CAGGGAAAAGCCCATGAGGTTGG - Intergenic
1101850415 12:108397457-108397479 CAGTGCAAAGGCCAGGAGGCAGG + Intergenic
1102431710 12:112889211-112889233 CAGGCAAAAGCCCAGAAGAAGGG - Intronic
1102548609 12:113674664-113674686 GAGGGAAAAAACTAGGAGAAAGG - Intergenic
1103134262 12:118493976-118493998 CAGGGAAAAGGCAGGGAGAAGGG + Intergenic
1103739363 12:123081106-123081128 GAGGGAAGAGACCAGGAGCTAGG - Intronic
1103830567 12:123775789-123775811 CATGGAAGAGCCCAGGTGGAGGG + Intronic
1104073761 12:125371367-125371389 CTGGGAAGAGACAGGGAGGAAGG + Intronic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1105454368 13:20526380-20526402 CCCGGAACAGACCAAGAGGAAGG + Intergenic
1105900171 13:24746438-24746460 CACAGCAAGGACCAGGAGGACGG - Intergenic
1106243082 13:27925456-27925478 GAGGGAGAAGAAGAGGAGGAGGG - Exonic
1106538357 13:30667893-30667915 AAGAAAAAAGACCAGGAGGAAGG + Intergenic
1106662988 13:31821829-31821851 AAGAGAAAAGCCCAGGAAGATGG - Intergenic
1106888549 13:34217114-34217136 CAGGGAACAGGACAGGAGGCAGG - Intergenic
1107336550 13:39361913-39361935 GAGGGAAAAGGGCAGGAGGGAGG + Intronic
1107378717 13:39832691-39832713 TAGTGAAAAGGCCAGGTGGATGG - Intergenic
1107962694 13:45572651-45572673 CATGGAAAATACCAAGAAGAAGG + Intronic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1108727976 13:53201910-53201932 CAGGCAAAAGACGAGGACTAGGG + Intergenic
1109150588 13:58843099-58843121 TAGGAAAAAGACCAATAGGAGGG + Intergenic
1109175199 13:59146468-59146490 CAGAGAAAAGAGCAAGATGATGG + Intergenic
1110076087 13:71244913-71244935 TAAGGAAAAGAAAAGGAGGAAGG - Intergenic
1111020634 13:82444780-82444802 CAAGGAAAAAATCAGGAGGAGGG - Intergenic
1111315640 13:86555296-86555318 CAGGGAAGAGAGCAGGATCAAGG + Intergenic
1112842894 13:103601407-103601429 CCCGGAAAAGAGCAGGAGCAAGG + Intergenic
1113091274 13:106619379-106619401 AAGGAAGGAGACCAGGAGGAAGG - Intergenic
1114407538 14:22470771-22470793 CAGGGACAAGAGCAGAAGCAAGG - Intergenic
1114465922 14:22922671-22922693 AAGGGAAGAAAGCAGGAGGAAGG + Intronic
1114495369 14:23128134-23128156 CAGGCTGAAGACCAGCAGGAAGG + Exonic
1114528515 14:23380890-23380912 CAGGAAAAAGACCAAGAGAGAGG - Intergenic
1114657083 14:24322745-24322767 CAGGGAGAAGGCCAGGAAGGGGG - Intronic
1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG + Exonic
1114866167 14:26597833-26597855 CGGGGAGAAGCCGAGGAGGAGGG + Intergenic
1115231471 14:31165411-31165433 CAGAGAGAAGAACTGGAGGAAGG - Intronic
1116179111 14:41513345-41513367 CAGGGCAAAGTCCAGTGGGAAGG - Intergenic
1116573189 14:46544519-46544541 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117411993 14:55458427-55458449 CAGGGAAAATCCCAAGAAGAGGG - Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117644490 14:57837321-57837343 CAGCGAAAAGAGCAGAAGGGAGG + Intronic
1118101578 14:62610889-62610911 CAGGGAGAAGACTGGGAGGGTGG + Intergenic
1118361587 14:65061844-65061866 AAGGGAAAAGAGCTGGAGGTGGG + Exonic
1118607136 14:67512780-67512802 CAGGAAAAAGCCCACCAGGAAGG + Intronic
1118889435 14:69895687-69895709 CAGGGAGAAGACAAGAAGTATGG - Intronic
1118982154 14:70725560-70725582 CAGGGAAAAGCCCAGGACTGAGG + Intronic
1119172317 14:72544757-72544779 CAGGGGAAGGAACAGGGGGATGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119693647 14:76695785-76695807 CAGGGAAGAAACCCTGAGGAGGG - Intergenic
1120238784 14:81925311-81925333 CAGGGAAAAGCAGAGGAGAATGG - Intergenic
1121239596 14:92419283-92419305 CTGGGAAGGGACCTGGAGGAAGG - Intronic
1121664144 14:95659088-95659110 GAAGTACAAGACCAGGAGGAAGG + Intergenic
1122025501 14:98873000-98873022 AAAGGTACAGACCAGGAGGAGGG - Intergenic
1122234748 14:100325293-100325315 CTGGGCAAAGGCCAGGAGGAGGG - Intronic
1122627979 14:103093979-103094001 CAGGGAAAATCCAAGGAGAACGG - Intergenic
1123450488 15:20356806-20356828 CAGGGCGAAGGCCCGGAGGAGGG - Intergenic
1123988387 15:25665198-25665220 CAGGGCAAAGACAAGGACCAAGG + Intergenic
1125045436 15:35239112-35239134 CGGAGCAAAGAGCAGGAGGACGG - Intronic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125480477 15:40075857-40075879 AATGGAAAAGACCAGGAGAGTGG + Intergenic
1125511840 15:40296408-40296430 GAGGGCAAAGAAGAGGAGGATGG + Intronic
1125882918 15:43209223-43209245 CAGGGAACAACCCAGGAGGCAGG + Intronic
1126060273 15:44774146-44774168 CAAAGAAAAGTCCAGGAGGCTGG - Intergenic
1126443869 15:48720204-48720226 CAGAGAGAAGATCTGGAGGAAGG + Intronic
1126864560 15:52922855-52922877 CTGGGAAAAGCCCAGGAAGATGG + Intergenic
1127296230 15:57610965-57610987 CAGCAAAAAGACCAAGAAGAAGG + Intronic
1127687925 15:61366550-61366572 CAGGGTGAAGACTAGGATGAGGG + Intergenic
1128142710 15:65313459-65313481 CAGGGAAAAGAACATGAAGATGG - Intergenic
1128550680 15:68596265-68596287 CAGGGACAGGCCCAGGAGGATGG + Intronic
1128667285 15:69547801-69547823 CATGGAAAAGACCGGTATGAAGG - Intergenic
1129028800 15:72604265-72604287 CTGGGAGAAGACCTGGAAGAGGG + Intergenic
1129175604 15:73837763-73837785 CAGGATAGAGACCAGAAGGATGG + Intergenic
1129253492 15:74321091-74321113 CAGGGACAAGTCGGGGAGGATGG - Intronic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1132770761 16:1561666-1561688 CGGGGAAAAGGCAAGGGGGAAGG + Intronic
1132836964 16:1958994-1959016 CAGGGAGCAGACCAGGAGGCAGG - Intergenic
1132959080 16:2612309-2612331 CAGGGCCAAGCCCAGGAGGCAGG + Intergenic
1132972140 16:2694284-2694306 CAGGGCCAAGCCCAGGAGGCAGG + Intronic
1133118631 16:3592721-3592743 CAGAGCTAAGGCCAGGAGGAAGG + Exonic
1133420385 16:5641676-5641698 CAGGGCAAAGGCCTGGAGGCGGG + Intergenic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1135358743 16:21792989-21793011 CAGAGAAAAGTCTAGAAGGATGG - Intergenic
1135457299 16:22609425-22609447 CAGAGAAAAGTCTAGAAGGATGG - Intergenic
1136740526 16:32518850-32518872 CAGGATAAAAACCAGAAGGAAGG - Intergenic
1136775107 16:32867710-32867732 GAGGGAAAAGACCAGGGGCTTGG + Intergenic
1136895511 16:33993802-33993824 GAGGGAAAAGACCAGGGGCTTGG - Intergenic
1137386510 16:48047531-48047553 AAGGGAAAGGAACAGGAGGAAGG + Intergenic
1137399651 16:48142958-48142980 CAGGGAGTAGAGCAGGAGCATGG + Intronic
1137669868 16:50272702-50272724 CAAGGAGATGCCCAGGAGGAGGG - Intronic
1137801040 16:51262205-51262227 CAGGAAGAAGACAGGGAGGAAGG - Intergenic
1137871043 16:51950613-51950635 GAGGGAAAAGAGCATGAGAAGGG + Intergenic
1137995644 16:53208325-53208347 CAGTGAAGAGGCCAAGAGGAAGG + Intronic
1138157783 16:54721945-54721967 CAGAGACAAGGCCAGGATGAGGG + Intergenic
1138211094 16:55164034-55164056 CCTGGAAATGACCATGAGGAAGG - Intergenic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138396120 16:56706067-56706089 AAGGGAAAGGACCAGGAGTGGGG - Intronic
1138535761 16:57659544-57659566 CAGGGAGAAGTGCAGGAAGATGG - Exonic
1138928979 16:61629159-61629181 CGGGAGAAAGACAAGGAGGAAGG + Intergenic
1139619464 16:68125541-68125563 CAGGGAAAGGCGCAGTAGGAAGG + Intronic
1140123380 16:72101757-72101779 CAGTGAAGAGACCAGGAGGAAGG - Intronic
1141065878 16:80913266-80913288 GATGGAAAAGAGCAGGTGGATGG + Intergenic
1141779993 16:86152957-86152979 CTGGGCAAAGACCTGAAGGATGG + Intergenic
1142312938 16:89324350-89324372 GAGGGAAAAAGCCAGGAGGGCGG + Intronic
1203029080 16_KI270728v1_random:556384-556406 CAGGATAAAAACCAGAAGGAAGG + Intergenic
1203042641 16_KI270728v1_random:778047-778069 CAGGATAAAAACCAGAAGGAAGG - Intergenic
1203077525 16_KI270728v1_random:1129819-1129841 GAGGGAAAAGACCAGGGGCTTGG + Intergenic
1142700618 17:1658049-1658071 CAGGAAACAGACCAGCTGGAAGG + Intronic
1143412012 17:6714611-6714633 AAGGGAAAAGGACAGGAGGGAGG - Intergenic
1143851885 17:9818956-9818978 CAGGCACAGGGCCAGGAGGATGG - Intronic
1143882426 17:10039909-10039931 AAGAGAAAAGACCAGGAAGGTGG - Intronic
1144406616 17:14958055-14958077 CTGGAAAAAGAATAGGAGGAAGG + Intergenic
1144422846 17:15113855-15113877 CAGGGAAGAGATGAGGAGGCTGG + Intergenic
1144486137 17:15665936-15665958 CTGAGAAAAGAACATGAGGAGGG - Intronic
1145934229 17:28705611-28705633 TAGGGAAAAGCCCTGGAGAAAGG + Intronic
1146282728 17:31555635-31555657 CAGGGGAAAGGCAAGCAGGAAGG - Intergenic
1146935862 17:36812430-36812452 CAGTGCAAAGGCCTGGAGGAGGG - Intergenic
1147006290 17:37406760-37406782 CCGGGAAAAGGCCAAGAGGGCGG + Intronic
1147155470 17:38542541-38542563 CAGGAAAAAGATCTGGAGGTGGG + Intronic
1147579981 17:41622735-41622757 CAGGGAATAGAAGAGAAGGAGGG - Intronic
1147587525 17:41660881-41660903 CAGGGGATTCACCAGGAGGAGGG + Intergenic
1147772416 17:42877196-42877218 CAGGGAACAGGCCAGGCGCAGGG - Intergenic
1148897783 17:50850022-50850044 AAGGAAAGAGTCCAGGAGGAGGG + Intergenic
1149393463 17:56215489-56215511 AAGGGACAAGAACAGGAAGATGG + Intronic
1149482941 17:57018144-57018166 CAGGGAGAAGACCGGCAGAAGGG - Intergenic
1149910971 17:60566404-60566426 AAGGGTAAACACCAGGAGGCAGG - Intronic
1150197619 17:63317313-63317335 CAGGGAAATGACAAGGAGGGGGG - Intronic
1150272107 17:63873305-63873327 CAGGGCAAAAGCCAGGAGCAGGG + Exonic
1150275655 17:63896201-63896223 CAGGGCAAAAGCCAGGAGCAGGG + Exonic
1150277787 17:63910890-63910912 CAGGGCAAAAGCCAGGAGCAGGG + Exonic
1151439778 17:74120653-74120675 CAGGGAAATGACCCAGAGAAGGG + Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151835916 17:76582719-76582741 CAGGGGACAGTCCAGGAAGATGG - Intronic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152739140 17:82011440-82011462 CGGGGAAAGGCCCAGGAGGGTGG + Intronic
1152784367 17:82240328-82240350 CAGGGAGCAGACGAGGAGGTGGG + Intronic
1152913059 17:83016552-83016574 TAGGGAAGAGAACAGGAGGTTGG + Intronic
1152928375 17:83098228-83098250 GAGGGAAAAGGGCAGGTGGAGGG - Intergenic
1153321243 18:3776104-3776126 GAGGGAAAAGACGGGGAAGATGG + Intronic
1153682664 18:7515191-7515213 GAGGGAAAAGAAGAAGAGGAAGG - Intergenic
1154345800 18:13542644-13542666 CAGGGAGAAGATAAGGAGGCGGG + Intronic
1154975432 18:21452819-21452841 CAGAAAAAAGAACAGGAGAAAGG + Intronic
1155029004 18:21967961-21967983 CAGAGAAAAGACTAGGAAAATGG + Intergenic
1155059575 18:22216886-22216908 CAGGGAAAAGGCCCCGAGTAAGG - Intergenic
1156341581 18:36214509-36214531 CAGGGAAGAGACAGGGAGGGTGG - Intronic
1156472597 18:37387198-37387220 CCGGGAAAAGGCAGGGAGGAAGG - Intronic
1156805374 18:41172798-41172820 TAGGGAAAAGAATGGGAGGAGGG - Intergenic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1157513084 18:48292490-48292512 CAGGGACAGGCGCAGGAGGAGGG - Intronic
1157579926 18:48768036-48768058 CAAGGAGAAGGGCAGGAGGATGG - Intronic
1158336050 18:56415935-56415957 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1159833956 18:73313324-73313346 CATAGAAAAGACAAGGAAGATGG - Intergenic
1160496950 18:79381352-79381374 CAAGCAGAAGCCCAGGAGGAAGG + Intergenic
1160875438 19:1294432-1294454 CAGGGCAAAGGCCTGGAGGCAGG + Intronic
1160876927 19:1300695-1300717 GGAGGAAATGACCAGGAGGACGG - Intergenic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1161761040 19:6173035-6173057 CTGGGAAAAGACATGGAGAAGGG - Intronic
1162343337 19:10105602-10105624 CAGGGGGAAGACGAGGGGGAGGG + Intergenic
1162496328 19:11025174-11025196 CAGGGACAGGGCCAGCAGGACGG - Intronic
1162737522 19:12754816-12754838 CCGGGCAAGGACCAGGTGGAGGG + Intronic
1162846637 19:13397817-13397839 AAGGGAAAAGAGCATGAGAAGGG - Intronic
1162944191 19:14032260-14032282 TAGGGAAATGAGCAGCAGGAAGG - Intronic
1164574853 19:29399925-29399947 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1165439479 19:35816445-35816467 CAGTGAAAAGACAAAGAGGGAGG - Intergenic
1165480336 19:36059818-36059840 CAGCGTAAACACCTGGAGGAGGG + Intronic
1165497276 19:36160506-36160528 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1165510615 19:36264719-36264741 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1166066118 19:40360065-40360087 TGGGGAAAAGACCAGGAGTTTGG - Intronic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1166203542 19:41253919-41253941 GAGGGAAGAGACCAGAAGGTGGG + Intronic
1166707197 19:44914615-44914637 CAGGGGAAGGCTCAGGAGGAGGG + Intronic
1166709302 19:44926711-44926733 CAGGGGAAGGCTCAGGAGGAGGG + Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167640392 19:50678537-50678559 CAGGGAAGGGACCAGGGTGATGG + Intronic
1167839848 19:52106778-52106800 AAGAGAAAATAGCAGGAGGAAGG - Intergenic
925448674 2:3950576-3950598 CAGGCAAAAGCGCAGGACGAAGG - Intergenic
926222361 2:10944645-10944667 CAGGGAAGGGGCCAGGAGGAAGG - Intergenic
926301359 2:11605620-11605642 GTGGGAAAAGGACAGGAGGAAGG - Intronic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
926716787 2:15930798-15930820 GAGGGAAAAGACCAAGAGCATGG - Intergenic
926803424 2:16682830-16682852 CAGGGAAAAGGAGAGGATGACGG + Intergenic
927081331 2:19633761-19633783 CAAGGAAGAGCTCAGGAGGAGGG - Intergenic
927810855 2:26179566-26179588 GAGGGCAAGGACAAGGAGGAGGG + Intronic
927940950 2:27102476-27102498 CAGGGAGAAGACCAGGCCCAGGG - Intronic
928341093 2:30443793-30443815 GAGGCAAAAGACCAGGAGTCAGG + Intergenic
928704334 2:33931410-33931432 CAGGAAAAAGAGCAGCAAGATGG - Intergenic
928704497 2:33933378-33933400 CAGGCAAAAGAGCAGCAAGATGG - Intergenic
929044681 2:37778091-37778113 ATGGGAAGAGACCAGGAGCAAGG - Intergenic
929422925 2:41813195-41813217 TAGAGAAAAGACCAAGAGTATGG + Intergenic
930153929 2:48086113-48086135 CAGGCAAGAGAGCAGGTGGAGGG + Intergenic
930241552 2:48940887-48940909 CAAGGGAAAGAAGAGGAGGAGGG - Intergenic
930261698 2:49154391-49154413 CAGCAAAGAGACCAGGAGCAGGG + Exonic
930317563 2:49816327-49816349 TAGGGAAAAGATTAGGGGGATGG - Intergenic
930419484 2:51133424-51133446 CTGGAAAGAGACCAGGAGAATGG + Intergenic
931093823 2:58917298-58917320 AAGGCTAAACACCAGGAGGATGG - Intergenic
931544788 2:63371096-63371118 GTGGGAAAAGACCAGGAGTTTGG - Intronic
931622903 2:64229046-64229068 CAGGAAAAAAACCATGAGGTAGG - Intergenic
932974266 2:76579180-76579202 CGGAGCAAAGAACAGGAGGACGG + Intergenic
933278028 2:80303604-80303626 CAGGGACAAGCCCAGCAGGCCGG + Exonic
933324892 2:80823110-80823132 CAGGGACAACACCAAGACGAAGG + Intergenic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
933670863 2:85006067-85006089 TAAGAAAAAGACCAGTAGGAGGG - Intronic
933730920 2:85455805-85455827 CAGGGGACAGACAAGCAGGAAGG + Intergenic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
934939273 2:98488781-98488803 CAGGGAAAGGACCAGGAGACTGG + Intronic
935308851 2:101762778-101762800 CACTGAAAAGCCTAGGAGGAGGG - Intronic
935460532 2:103327738-103327760 AGGGGAAAAGCCCAGCAGGATGG - Intergenic
935847715 2:107184834-107184856 AAGGGAGAAGGGCAGGAGGAAGG + Intergenic
935945861 2:108286102-108286124 CAGGGAAAAATCCATGTGGATGG + Intergenic
936737305 2:115462212-115462234 TAGGGAAAGGACCAGGAAAAGGG - Intronic
937034459 2:118769387-118769409 CAGGGTAAAGTCCACGTGGAGGG - Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937907342 2:127058736-127058758 CAGACAAAAGACCAGGGAGAGGG + Intronic
937941446 2:127289301-127289323 CAGTGAAGGAACCAGGAGGAAGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938308145 2:130268333-130268355 CAGGGAAGTGAAAAGGAGGAGGG - Intergenic
938447186 2:131388503-131388525 CAGGGAAGTGAAAAGGAGGAGGG + Intergenic
938938313 2:136146946-136146968 CAGGGAAATGACCACCAGGTGGG - Intergenic
941072062 2:160966678-160966700 CAGGGAGAGGAGCAGGGGGAAGG + Intergenic
942775514 2:179576767-179576789 CAGGGAAGAGACCAGGAAGCAGG + Intronic
943183936 2:184580798-184580820 CAGAATAAAGAACAGGAGGAAGG - Intergenic
943795468 2:191987245-191987267 GAGGGAAATGAGGAGGAGGAAGG + Intronic
943902343 2:193456218-193456240 CAGTGAAAGGACCAGTAGGTCGG - Intergenic
944699124 2:202230417-202230439 GAAGGAAAAGACCTGAAGGAAGG - Intronic
944936459 2:204574056-204574078 GAGGGAAAAGCCCAGAAGAAAGG - Intronic
945510204 2:210692082-210692104 CAAGGAAAAGACCAAAGGGAGGG - Intergenic
946451118 2:219780309-219780331 CAGGGCAAATATCAGGAGAAAGG + Intergenic
946858316 2:223975676-223975698 GAGGGAAAAAACAAGCAGGATGG - Exonic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947351675 2:229252870-229252892 TAGAGAAAAGACAAGGAGGTGGG + Intronic
947731297 2:232433042-232433064 CAGGGAGCAGACCAGGGGAAAGG + Intergenic
948014116 2:234673858-234673880 GAGAGAAAGAACCAGGAGGAAGG + Intergenic
948117940 2:235507515-235507537 AAGGGAAGAAACCAGGAGGATGG - Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
1168935030 20:1657669-1657691 GCAGGAAAGGACCAGGAGGATGG + Exonic
1169060785 20:2659124-2659146 TAGAGACAAGACCAGGTGGAAGG + Intronic
1169827640 20:9787334-9787356 CAGTGCAAAGACCTGGAGGTGGG - Intronic
1169855653 20:10099694-10099716 CAGGCAAAAGACCATGTGCAGGG - Intergenic
1169945695 20:10985685-10985707 CAGGGAAAAGAAATAGAGGACGG - Intergenic
1170069146 20:12345434-12345456 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1170165583 20:13358382-13358404 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1170215453 20:13886133-13886155 CAGGGAACAAAACAGGAGTAGGG + Intronic
1170560927 20:17557605-17557627 CAGGCAAGAGACCTGGAAGAAGG - Intronic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1170834473 20:19871944-19871966 CAGGGAAAAGCCCATGAACAGGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1172250855 20:33478121-33478143 TATGGAAAAGAGCAGGATGAAGG - Intergenic
1173177286 20:40773836-40773858 TGGGGAAAACAACAGGAGGAAGG + Intergenic
1173447911 20:43137055-43137077 CAGGTAGAAGACCAGGAGACGGG - Intronic
1173658182 20:44715410-44715432 GAGGGAGAAGGCCAGGAGGTGGG - Exonic
1173908548 20:46646933-46646955 CAGGTAGATGACCAGGAAGATGG - Intronic
1174122236 20:48274710-48274732 CAGGGAAAAGACCTTGAAGCAGG - Intergenic
1174156960 20:48521810-48521832 TGGGGAACATACCAGGAGGAAGG - Intergenic
1174434980 20:50499846-50499868 GAGGGTGAAGACCAGCAGGAAGG - Intergenic
1174631644 20:51963355-51963377 CAGTGAAAAGACTAGGGAGAAGG - Intergenic
1175104227 20:56602985-56603007 CTGGGAAAAAGCCAGGAAGATGG + Intergenic
1175516588 20:59574274-59574296 CACTGGAGAGACCAGGAGGAGGG - Intergenic
1176605229 21:8824717-8824739 CAGGTAAAAGAGGAGGTGGATGG - Intergenic
1177402699 21:20626077-20626099 CAAGGAAAAGACAAAGAGGAAGG + Intergenic
1178156182 21:29856803-29856825 CAGCACAAAGAACAGGAGGATGG + Intronic
1178749219 21:35284498-35284520 CAGGGCAAAGACCCTGAGGTGGG - Intronic
1179300639 21:40106248-40106270 CATGGGAAAGACCCGGTGGAAGG - Intronic
1180187760 21:46148197-46148219 CAGTGAAGGGTCCAGGAGGAAGG + Intronic
1180560608 22:16611797-16611819 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1181313868 22:21959842-21959864 TAGGGCAGAGGCCAGGAGGACGG - Intronic
1181441709 22:22939378-22939400 CAGGGAGAACACCACCAGGATGG + Intergenic
1181466417 22:23112933-23112955 CAGCCAAGAGACCAGGAGCAGGG + Intronic
1181570314 22:23764722-23764744 CAGGGTACAGCCCAGGGGGAGGG + Intronic
1181673446 22:24436855-24436877 CTGGGACAAGACCCTGAGGAAGG + Intronic
1182033165 22:27176067-27176089 AAGGGAAAAAAGCAGAAGGAAGG + Intergenic
1183054451 22:35294841-35294863 TTTGGAACAGACCAGGAGGAAGG - Exonic
1183190194 22:36317446-36317468 CAGGGAAACGAACAGGTGGCAGG + Intronic
1183718929 22:39550937-39550959 CAGAGAAACGCCAAGGAGGAAGG + Intergenic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1184022227 22:41828459-41828481 GAGGAAAGAGCCCAGGAGGAAGG - Intergenic
1184243321 22:43222880-43222902 CAGGGAAGTGGCCAGGAGGAAGG + Intronic
1184449718 22:44575775-44575797 AAGGGGAAAGAAGAGGAGGAGGG + Intergenic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
1185072980 22:48667357-48667379 CAGGAGGCAGACCAGGAGGAAGG + Intronic
1185101111 22:48841358-48841380 CAAGGGAGAGACCAGGTGGAGGG - Intronic
1185103323 22:48853328-48853350 CAAGGGAGAGACCAGGTGGAGGG + Intergenic
1185280692 22:49968680-49968702 CAGGGACCTGGCCAGGAGGATGG - Intergenic
1185281084 22:49970190-49970212 CATGGAGTAGACCAGGAGGCAGG - Intergenic
1185330907 22:50251634-50251656 CAGGGCAAAGGCCACGAGGCGGG + Intronic
1185416167 22:50711756-50711778 CAGGGAGAAGGCCAACAGGAGGG - Intergenic
949764692 3:7513222-7513244 CTGTGAAAACACCAGGAGAAAGG - Intronic
949952841 3:9243295-9243317 AATGGGAAAGACCTGGAGGAGGG + Intronic
950399702 3:12760457-12760479 CAGGGCAAAGGCCCTGAGGAGGG - Intronic
950475441 3:13211722-13211744 CAGGGCAAAGGCCTGGAGGCTGG - Intergenic
950506877 3:13400476-13400498 CAGGGAGGATAACAGGAGGAAGG + Intronic
950542207 3:13619382-13619404 CAGGGAAAAAAGCAGGGGAAGGG - Intronic
950943000 3:16912974-16912996 AAGGGAGAAGAACAGAAGGAAGG - Intronic
951887959 3:27542544-27542566 CATTGAAAAGGCCAAGAGGATGG + Intergenic
952255638 3:31693106-31693128 CAGGGAGAAGAACAGCTGGAGGG + Intronic
952478727 3:33737595-33737617 CAGGGAAAAGAAGAGGGGAAAGG - Intergenic
952819203 3:37471394-37471416 GAGAGAAAAGACCAGAGGGAAGG + Intronic
953236053 3:41108182-41108204 CAGGTAAAGAACCAGGAAGAAGG - Intergenic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954536482 3:51362825-51362847 CAGGGAAGAGGCCTGGAGGCAGG - Intronic
956823314 3:72973311-72973333 CAGGGGAAAGTCCCGGAGGCAGG + Intronic
957957142 3:87202049-87202071 CAGGGAAAAGCCACTGAGGAGGG + Intergenic
958648325 3:96902117-96902139 CATGGAAAGGACAAGGACGATGG + Intronic
958675660 3:97265529-97265551 CAGAGCAAGGACCAGGAGTAGGG + Intronic
958709571 3:97700963-97700985 CAGGCCAAAGTCCAGGAGGCAGG + Intronic
959174985 3:102896902-102896924 CAGGGACAAGATCAGGACTAGGG - Intergenic
959578213 3:107957703-107957725 CAAGGAAAGGAGGAGGAGGAGGG + Intergenic
959972563 3:112422840-112422862 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
960390853 3:117075923-117075945 CAGGGAAAAAAACATGAGGATGG - Intronic
960874529 3:122283906-122283928 CAGGGAGAAGAGGAGGAGGTAGG - Exonic
960942027 3:122941164-122941186 CAGGCAGAAGAAAAGGAGGAAGG + Intronic
961730292 3:128960301-128960323 CGGAGCAAAGAGCAGGAGGACGG - Intronic
961788021 3:129359131-129359153 CAGGGCAAAGGCCCGGAGGCTGG + Intergenic
961809592 3:129514252-129514274 CAGAGGAAAGACCGTGAGGAAGG - Intronic
961910261 3:130307603-130307625 CAGGGAGAAGAATGGGAGGAGGG + Intergenic
962453817 3:135546961-135546983 CAGGGAAAGGTGCAAGAGGAGGG - Intergenic
962874229 3:139523451-139523473 CAAGGAGAAGCCCTGGAGGATGG + Intronic
963255421 3:143139976-143139998 AGCGGAAAAGACAAGGAGGAAGG - Intergenic
963798789 3:149657462-149657484 CAGCGGTAAGACCAGCAGGATGG + Intronic
963836350 3:150061703-150061725 CAGGGAGACAGCCAGGAGGAAGG - Intergenic
965716144 3:171605259-171605281 CAGTGAAAAGAAACGGAGGAGGG + Intronic
966446988 3:180011760-180011782 AAGGGAAGGGAGCAGGAGGAAGG - Intronic
967109935 3:186284277-186284299 AAGGGAAAAGGGCACGAGGAAGG - Intronic
967191959 3:186992179-186992201 CAAGGGAGAGACCAGGTGGAGGG + Intronic
967267482 3:187703166-187703188 CATGGAAAAGACCAGGCATATGG + Intronic
967815520 3:193795240-193795262 CAGGGAAAGGCACGGGAGGAGGG + Intergenic
967890022 3:194358225-194358247 CTGGGAAAAGCCCAGGATGGGGG + Exonic
968539306 4:1155213-1155235 GAGGGAACAGACCAGTGGGAAGG - Intergenic
968653674 4:1769767-1769789 CAGGGATGAGACAAGGAGGCAGG - Intergenic
970342129 4:15118499-15118521 CAGGGAACAGACGTGGAGGTGGG - Intergenic
971133851 4:23844966-23844988 CAGGGAAAAGAGTAAGAGTAAGG + Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971199826 4:24501477-24501499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
971335669 4:25721681-25721703 CAGGGAAATTCACAGGAGGAAGG + Intergenic
972358680 4:38305969-38305991 GAGGGACAAGACCAGAAGGTGGG + Intergenic
974359980 4:60865053-60865075 CAGGGAAAGGACAAGAAGAAGGG - Intergenic
975193133 4:71489936-71489958 CAGGGAAAAGAGCAGGAGAGAGG + Intronic
975673744 4:76806628-76806650 CAGTGGAAAGACCAAGATGAAGG + Intergenic
976515047 4:85955298-85955320 CATGGAAAACTCCAGAAGGAAGG - Intronic
976757437 4:88513454-88513476 TAGGAAAAAGAACAGGAAGAAGG - Intergenic
977041710 4:92026292-92026314 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
977666990 4:99653662-99653684 GAGAGAAAATATCAGGAGGAGGG - Exonic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
977789320 4:101079800-101079822 CAGGGAAAAGAAGAAGAGCAAGG - Intronic
978083564 4:104622672-104622694 CAGGGAAAAGAGCCCGAGCATGG + Intergenic
979003840 4:115262587-115262609 CATGGAAAAAATCAGGAGGCTGG + Intergenic
979251941 4:118574840-118574862 AAGGGGAAAGAGCAGCAGGAGGG - Intergenic
980229401 4:130029616-130029638 CAGGGAAGTGCCCAGCAGGAGGG + Intergenic
980533694 4:134087797-134087819 GAGGGAAAAGGCCAGGAGGAAGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981157070 4:141450820-141450842 CAGGACAAAGAAGAGGAGGAAGG - Intergenic
981308623 4:143272890-143272912 TAGAGAAAAGTCCAGGAGCAAGG + Intergenic
981320632 4:143387563-143387585 GAGGGAAAAGTCCAGGAGTTAGG - Intronic
981515127 4:145599435-145599457 ATTGGAAAAGACCAGGAAGAGGG - Intergenic
982653292 4:158114502-158114524 CATGGAAAAGCACAGGAGGAGGG + Intergenic
983204471 4:164898642-164898664 CAGTGAATAGACCAGATGGAGGG + Intronic
983286306 4:165743652-165743674 CTAGGAAAAGATCTGGAGGAAGG - Intergenic
983360086 4:166716627-166716649 CGGAGCAAAGAACAGGAGGACGG - Intergenic
984858669 4:184217778-184217800 CAGGGCAAGGGCCAGCAGGAGGG + Exonic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985644058 5:1076816-1076838 CAGGGAGAAGGGCAGGAAGATGG + Intronic
985825995 5:2192055-2192077 CAGGGCAGAGGCCAGGTGGAAGG - Intergenic
986047839 5:4057791-4057813 CTTGGAAAACACCAGCAGGATGG - Intergenic
986243220 5:5980299-5980321 CAGAGAGAAGACTTGGAGGAAGG - Intergenic
986538884 5:8822547-8822569 CAAGGACAGTACCAGGAGGATGG - Intergenic
986750836 5:10786644-10786666 CAACCAAAACACCAGGAGGAAGG + Intergenic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
988680359 5:33479150-33479172 GAGGCTAAAGCCCAGGAGGAGGG - Intergenic
989679124 5:44008606-44008628 CAGGGAAATGACCAGCAGTTGGG + Intergenic
990608908 5:57438044-57438066 CAGGAAAATGAACTGGAGGAAGG + Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
991111533 5:62905428-62905450 CAGGGAAGGGACCAGGTGGGAGG - Intergenic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992180557 5:74193244-74193266 AAGGGAAAAGGCAAGGAGAAAGG + Intergenic
992892084 5:81213115-81213137 CAGGGAGAAGGCCAGGAGAAAGG - Intronic
992962563 5:81971164-81971186 CAGGGCAAAGGGCTGGAGGAAGG - Intergenic
993755820 5:91728321-91728343 CAAGGAAAGTACCATGAGGATGG + Intergenic
994030526 5:95136530-95136552 CAGGGAAAATTCAAGGGGGAGGG + Intronic
994057456 5:95434348-95434370 CATGGAAAACACAAGAAGGAAGG - Intronic
994246776 5:97487981-97488003 CTGGTATGAGACCAGGAGGAAGG + Intergenic
994563682 5:101412114-101412136 CATGGAAAAGACCCAGATGAGGG + Intergenic
994675557 5:102816942-102816964 GAGGGAAATGACCAGGAGTTTGG - Intronic
995152154 5:108861005-108861027 CAAGGGAAGGACCAGGTGGAAGG - Intronic
995477931 5:112566505-112566527 TAGGGAAAGGACCTGGTGGAGGG - Intergenic
995983238 5:118133873-118133895 CCGGAAAATGACCAGGAGAATGG - Intergenic
996403490 5:123086682-123086704 AAGGGAATAGACCAGGAGTCAGG - Intergenic
996915508 5:128707532-128707554 CAGGGAAGGGATCTGGAGGAAGG - Intronic
997590669 5:135070224-135070246 CAGTCCAAAGACCAGGAGCAGGG - Intronic
997701095 5:135899941-135899963 AAGGGTAAAGGCCTGGAGGATGG - Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
999743407 5:154574024-154574046 GAGGGAAAAGATCAGGGCGAGGG + Intergenic
1000009443 5:157217747-157217769 CAGGGAAAACAACAGAAGAAAGG - Intronic
1000332556 5:160217387-160217409 CAGAGAAAAGACAAGAAGAAGGG + Intronic
1001265254 5:170269408-170269430 CAGGGAAAAGGGTAGGAGCAAGG + Intronic
1001848772 5:174944541-174944563 CAGTAAAAAGACATGGAGGATGG + Intergenic
1002878439 6:1231633-1231655 CAGTGAAAAGACCAGGGCAATGG + Intergenic
1002915771 6:1526535-1526557 CAAGGAAAGGACCATGAGGATGG + Intergenic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1003411840 6:5871826-5871848 CAAGGAAAAGACCACCAGGAGGG - Intergenic
1003523874 6:6882501-6882523 GGAGGAAAAGAGCAGGAGGATGG - Intergenic
1003806102 6:9727429-9727451 CAGTGAAAGGGCCAGGAGGTCGG - Intronic
1004091133 6:12503025-12503047 CTGGGCAAAGACTTGGAGGAAGG - Intergenic
1004459817 6:15825449-15825471 AAGGGAAGAAACCAGAAGGAAGG - Intergenic
1004543460 6:16573759-16573781 CAGGGACAAAAGCATGAGGAAGG - Intronic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005089200 6:22038549-22038571 GAAGAAAAAGACAAGGAGGAGGG - Intergenic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1006297082 6:33174468-33174490 CAGGGAAGCGAAGAGGAGGAGGG + Intronic
1006334528 6:33413620-33413642 AAGGAAAAAGAACAGGATGAGGG + Intronic
1006789020 6:36686613-36686635 AAGGGAAAGGACAAGGGGGAGGG - Exonic
1007091151 6:39185647-39185669 GAGGCATAAGACCAGGAGGCAGG + Intergenic
1007136423 6:39526104-39526126 CAGGGAAATGACTAGAAGGGAGG - Intronic
1007554970 6:42758153-42758175 CAGGGAGAAGAAGATGAGGAAGG - Intronic
1007772648 6:44203474-44203496 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1007921920 6:45617947-45617969 CAGGGAAAAGAAAAAGGGGAGGG - Intronic
1008337851 6:50327972-50327994 TAGGGAAAAGACCAAAAGGAAGG - Intergenic
1008632978 6:53381703-53381725 CAGGAGAAAGACCTGGAGGTGGG - Intergenic
1009362624 6:62834378-62834400 GAGGGTAAAGAATAGGAGGAAGG - Intergenic
1009488376 6:64254614-64254636 CAGGGAACAAAGCAAGAGGAAGG - Intronic
1009887442 6:69640612-69640634 CAAGATAAAGACCAGGAAGAGGG + Intergenic
1009938357 6:70260003-70260025 CAAGGCAAAGACAGGGAGGATGG - Intronic
1010016826 6:71114509-71114531 CAAGGAAGAGACCAGGAACATGG + Intergenic
1010244534 6:73651053-73651075 CAGGGAAAAGAAAAGGAGCGGGG + Intronic
1010827206 6:80487635-80487657 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1010835959 6:80587532-80587554 CAGGCAAAAGAGCACGAGCAAGG - Intergenic
1011531267 6:88323887-88323909 CAGTGAAAAGACTAGCAGCAAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012604886 6:101145493-101145515 AAAGGAAAAAAACAGGAGGATGG - Intergenic
1012840526 6:104323874-104323896 GAGGGTAAAGAACGGGAGGAGGG + Intergenic
1012842364 6:104344960-104344982 CAGCCAAAAGACCAGGAAAATGG - Intergenic
1012865685 6:104615554-104615576 AAGGGAATATACCAGGAGGAGGG - Intergenic
1013685994 6:112583771-112583793 CAGGGAAAAAACTGGGAGGTGGG - Intergenic
1013891383 6:115032295-115032317 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1014480758 6:121933957-121933979 CAAGGGAAAGACCATGATGATGG - Intergenic
1014486628 6:122007255-122007277 GGTGGAAAAGACCAGGAGAAGGG + Intergenic
1014891269 6:126849326-126849348 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1016154334 6:140784825-140784847 ATGGGAAAAGACAAGGGGGAAGG + Intergenic
1016518505 6:144923658-144923680 CGGAGCAAAGAGCAGGAGGATGG - Intergenic
1016531715 6:145065689-145065711 CAGGGAAAAGAGGAGGAGTTTGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016863919 6:148747588-148747610 CAGGCAGAAGACCAGCAGGGTGG - Exonic
1017847853 6:158274882-158274904 TACGGAAAAGACCAGGACGTTGG - Intronic
1018090318 6:160340888-160340910 CAGAGAAAAGCCCAGGAGAATGG - Intergenic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1019063573 6:169276058-169276080 GTGGGAGAAGACCAGGAGGAGGG - Intergenic
1019487104 7:1294390-1294412 CAGGGGTGTGACCAGGAGGAGGG - Intergenic
1019763987 7:2836262-2836284 GAGTAAAAAGACCAGGATGATGG + Intronic
1019932571 7:4233771-4233793 CAGGGAGCAGCCCAGGAGGATGG - Intronic
1020080090 7:5282410-5282432 AAGGGAGGAGAGCAGGAGGAGGG + Intronic
1020642102 7:10768241-10768263 CTGGGATAAGACCAGGAGAATGG - Intergenic
1020766575 7:12329366-12329388 CAGGAAAAAGACCTGGAAAAGGG + Intergenic
1020950614 7:14671270-14671292 CAGAGAAAGGACCAGGAGTGAGG + Intronic
1021677992 7:23100131-23100153 CAGACAAAAGACCAGGTGGTGGG - Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022323151 7:29305803-29305825 GAGGAGAAAGACGAGGAGGAAGG - Intronic
1022329758 7:29366410-29366432 AAGGGTGAAGACCAGGAGGGTGG + Intronic
1023969042 7:44978233-44978255 CAGGGAGAAGCCCGGGAGGTAGG - Intronic
1024634365 7:51275320-51275342 GAGGGAAAAAACCAGGAGGATGG - Intronic
1024684795 7:51733711-51733733 CAGGGAAGAGAGCATGTGGAGGG + Intergenic
1025198831 7:56949806-56949828 AAGGGAGGAGAGCAGGAGGAGGG - Intergenic
1025673115 7:63627127-63627149 AAGGGAGGAGAGCAGGAGGAGGG + Intergenic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1029405514 7:100372355-100372377 CAGGGAAGAGACTAAGAGAAGGG + Intronic
1029551616 7:101239740-101239762 CAGGGAAAGGACAGCGAGGATGG + Exonic
1029875047 7:103741676-103741698 AAGGGAAAAGACAGGGAGGGAGG + Intronic
1030111636 7:106031689-106031711 TATGGAAAAGACAAGGAGCAAGG + Intronic
1030321989 7:108178977-108178999 CAGGGAAATGACAAAGAAGATGG - Intronic
1030751800 7:113238766-113238788 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1031783866 7:126004151-126004173 CAAGGAAGAGATCAGAAGGAAGG - Intergenic
1032366605 7:131305968-131305990 CAGGGAAAGGACCTGGTGGGAGG + Intronic
1032515715 7:132504641-132504663 CAGGGCAAGGCCCAGGAGGTTGG - Intronic
1032653412 7:133903068-133903090 CAGGGCAAAGGCCAGGAGGCAGG + Intronic
1033310669 7:140259744-140259766 CTAGGAAAAGACTTGGAGGAGGG + Intergenic
1033651744 7:143349137-143349159 CATAGAAAAGACCAAGAGGACGG + Intronic
1033679675 7:143582169-143582191 CAGAGAAATGAACATGAGGAGGG - Intergenic
1033692160 7:143747274-143747296 CAGAGAAATGAACATGAGGAGGG + Intergenic
1033953759 7:146817650-146817672 CAGGAACAAGAGCAAGAGGAAGG + Intronic
1034240332 7:149605876-149605898 CAGGGAAAGGCTAAGGAGGAAGG - Intergenic
1034706565 7:153151107-153151129 AGGGGAAAAGACAAGGAGAAAGG - Intergenic
1034738003 7:153446804-153446826 CAGGGAATAAAACAGAAGGAAGG - Intergenic
1034946231 7:155263552-155263574 TGGTGAACAGACCAGGAGGAGGG + Intergenic
1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG + Intergenic
1035286393 7:157809949-157809971 CATGGAAAATACCAGGCTGATGG + Intronic
1036508984 8:9383161-9383183 CAGACAGATGACCAGGAGGAAGG - Intergenic
1036603078 8:10281298-10281320 TGGGGAAAAGTCCAGGAGAATGG - Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1037432934 8:18832774-18832796 CAGGCAAAAGAGCAGGTGCAGGG + Intronic
1037529894 8:19762863-19762885 CAGGGAAAATAGCCTGAGGAAGG + Intergenic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037906398 8:22718301-22718323 CAGGAAAGGGATCAGGAGGATGG + Intronic
1037954287 8:23042135-23042157 CAGGGTCAAGACCAGGAAGCAGG - Intronic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1039712212 8:40067342-40067364 AAGGGGAAAGACCTGAAGGAAGG - Intergenic
1041029582 8:53723386-53723408 GAGGGAAAAGACCAGTAAGGAGG - Intronic
1041077896 8:54185928-54185950 CAGGGAGAAGCCCTGGGGGATGG + Intergenic
1041356639 8:57007386-57007408 CAGGGACAAGGCTAGGAGAAGGG + Intergenic
1041463153 8:58133503-58133525 AAGGCAAGAGCCCAGGAGGAAGG + Intronic
1042280590 8:67052187-67052209 CAGGGAAAAGGCAAGGTGTAGGG + Intronic
1042624845 8:70746909-70746931 AAGGGAGAAGACAGGGAGGAGGG - Intronic
1043617825 8:82149052-82149074 CATGTCAAAGACCAGGTGGAGGG + Intergenic
1043971307 8:86531703-86531725 CAATGAAAAGCCCAGGTGGAAGG - Intronic
1044127434 8:88475050-88475072 CTGGGAAAAGCCCAGGAGTTTGG + Intergenic
1044416776 8:91948477-91948499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1044462109 8:92457676-92457698 CCAGGAACAGACCAGGAAGAGGG + Intergenic
1044723214 8:95170193-95170215 CAGGCAGGAGACCAGGAGCATGG + Intergenic
1044769366 8:95613888-95613910 CAGGGAAAAGGGCAGGAAGGGGG - Intergenic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045644484 8:104286391-104286413 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1048288285 8:133159722-133159744 CAGGGGAGGGACCAGGTGGATGG + Intergenic
1048318512 8:133380022-133380044 CAGGGGAGGGACCAGGAGGTTGG - Intergenic
1048525472 8:135198384-135198406 GAGGGAAAAGAAAAGAAGGAAGG + Intergenic
1049343945 8:142128579-142128601 CTGGGAAAAGAGCAGGAGGGTGG + Intergenic
1049346018 8:142139086-142139108 CAGCAAAGATACCAGGAGGAGGG + Intergenic
1049697717 8:143991700-143991722 CATGGAAACTACCAGGAGGAGGG + Exonic
1050747374 9:8892036-8892058 CAGAGAAAAGAAAAGCAGGAAGG - Intronic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052049585 9:23830208-23830230 CAGGGAGAAGAACGGGGGGAGGG - Intergenic
1052665933 9:31495943-31495965 CAAGGGAGAGACCAGGTGGAGGG - Intergenic
1052819783 9:33129480-33129502 TAGGCAGAAGACCAGGAGTAGGG + Intronic
1052900820 9:33793576-33793598 CAGGAAGAAAAGCAGGAGGAAGG + Intronic
1052902362 9:33804271-33804293 CAGGAAGAAAAGCAGGAGGAAGG + Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055911958 9:81363500-81363522 CAGGGAAACAACCAAAAGGAAGG + Intergenic
1056241894 9:84655905-84655927 CAAAGAAGTGACCAGGAGGATGG - Intergenic
1056437571 9:86588514-86588536 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1056850997 9:90083985-90084007 CAAGGAATAGACCAGGCGTAGGG + Intergenic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1057447624 9:95128835-95128857 CAGGTAAGAGGCCAGGAGGCAGG + Intronic
1057572711 9:96216535-96216557 CAGGGAAAAGAAGAAGAGCACGG + Intergenic
1057834143 9:98430575-98430597 CAGGGAAAGAACCAGCAGAAAGG - Intronic
1059501718 9:114759973-114759995 CAGGGAAAAATCCAGGAGCGTGG - Intergenic
1059574285 9:115473684-115473706 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1059780532 9:117521730-117521752 CAGAAAAAGGACCAGGAGCATGG + Intergenic
1060035431 9:120251607-120251629 GAGGGAAAAGACCAGGGTTAGGG + Intergenic
1060546537 9:124465176-124465198 AAGGAGAGAGACCAGGAGGATGG - Intronic
1060711476 9:125869652-125869674 CATGGAAAATACCTGGAGCATGG + Intronic
1061044930 9:128160017-128160039 CCTGGAAAAGCCCAGGAGTAGGG - Intergenic
1061559464 9:131393783-131393805 CGGGGAGGAGACCCGGAGGAGGG - Intergenic
1061592734 9:131608504-131608526 CAGGGAAATGACCAGGGGTGTGG + Intronic
1061955845 9:133960927-133960949 CTTGGAGAAGCCCAGGAGGATGG + Intronic
1062339413 9:136087379-136087401 CAGGTGACAGGCCAGGAGGAGGG - Intronic
1185858882 X:3559656-3559678 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1186196693 X:7116425-7116447 CTGGGAAGAAACCAGGAGGCAGG - Intronic
1186772115 X:12828354-12828376 CAGGGAACAGTCCAGGCAGAAGG + Intergenic
1187078656 X:15962884-15962906 CAGTGATAAGCCCTGGAGGAGGG - Intergenic
1187131321 X:16506037-16506059 AAGTGAAAAGACAAGGAAGAAGG + Intergenic
1187353429 X:18543253-18543275 CAGCCAAAAGACCAGGAAAAGGG - Intronic
1187602056 X:20842772-20842794 AAGGGAAAATCCCAGGAGGCTGG + Intergenic
1187859348 X:23666521-23666543 CAGGGAAAAGGCCAGGGGTTGGG + Intronic
1188029313 X:25246932-25246954 CGGGAAAATGACCAGGAGGTGGG + Intergenic
1188107935 X:26165283-26165305 CAGGGCAAGGACAATGAGGAAGG + Intergenic
1188111329 X:26198540-26198562 CAGGGCGAGGACCATGAGGAAGG + Intergenic
1188332149 X:28887505-28887527 AAGGGAACAGACAAAGAGGAGGG - Intronic
1189961192 X:46326420-46326442 AAGAGAAAACACTAGGAGGATGG - Intergenic
1190303914 X:49071876-49071898 CTGGGACAAGAGCAGGAGGCTGG - Exonic
1190700241 X:52982648-52982670 CAGAGAAAAGATCTAGAGGACGG - Intronic
1191269150 X:58440185-58440207 CAGGGTAAAAACTAGAAGGAAGG - Intergenic
1192239930 X:69320871-69320893 CAGGGGAAAGACCTGGAGGCTGG - Intergenic
1192503026 X:71665625-71665647 CTGGGAAGAAACCAGCAGGAAGG - Intergenic
1192522550 X:71814997-71815019 CTGGGAAGAAACCAGCAGGAAGG + Intergenic
1192657435 X:73005408-73005430 CAGGGAAAAGGACAGGAAGTGGG - Exonic
1192664689 X:73077609-73077631 CAGGGAAAAGGACAGGAAGAGGG + Exonic
1193135691 X:77968817-77968839 GAGGGACAAGACCAGCAGGGAGG + Intronic
1193467198 X:81864881-81864903 CATGGAAAAGACCTGGTGGAAGG - Intergenic
1193851016 X:86537326-86537348 GAGGAAGAAGACCTGGAGGAAGG - Intronic
1194070981 X:89325918-89325940 CAGGGAAAAGGTAAAGAGGAAGG - Intergenic
1195268985 X:103212499-103212521 AAGGGAAAAGGCCAGTAGAAGGG + Intergenic
1195524366 X:105869482-105869504 AAGGGAAATGCCAAGGAGGAGGG - Intronic
1195681459 X:107550015-107550037 CAGGGAAAGGACAAGGAGACCGG - Intronic
1196003540 X:110811597-110811619 TAGGGAAAAGATCAGGTAGATGG + Intergenic
1196388469 X:115185636-115185658 CAGAGAAAAGATGGGGAGGAGGG - Intronic
1196717190 X:118823456-118823478 TAGGGAAAAGACGGGGAAGAGGG - Intergenic
1197064614 X:122222506-122222528 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1197714426 X:129696141-129696163 CAGGACAAAGGCCAGGAGCAAGG + Intergenic
1197871806 X:131068582-131068604 CAGTGAAAGGGCCAGGGGGAGGG - Intronic
1198184184 X:134237516-134237538 GAGGGAAAGGACCAGGACGTGGG + Intronic
1198197050 X:134373510-134373532 GCGGGAGAAGACAAGGAGGATGG + Intronic
1199350377 X:146793964-146793986 CAGGCAAAAGAGCAGGGGCAGGG - Intergenic
1200104824 X:153706350-153706372 GAGGGAAAAGACCAGGGGCTTGG - Intronic
1200691094 Y:6306687-6306709 CTGGGAAATGCCCTGGAGGAAGG + Intergenic
1200725211 Y:6661659-6661681 CAGGGAAAAGGTAAAGAGGAAGG - Intergenic
1201044178 Y:9868029-9868051 CTGGGAAATGCCCTGGAGGAAGG - Intergenic
1202109623 Y:21406342-21406364 CTGGGAAAATCCCTGGAGGAAGG + Intergenic
1202258391 Y:22943690-22943712 CACGGAAAGGGCCAGGAGGTTGG - Intergenic
1202411381 Y:24577448-24577470 CACGGAAAGGGCCAGGAGGTTGG - Intergenic