ID: 1138300809

View in Genome Browser
Species Human (GRCh38)
Location 16:55928404-55928426
Sequence CTGGAGACTCAGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 986
Summary {0: 2, 1: 8, 2: 62, 3: 229, 4: 685}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138300809 Original CRISPR CTGGAGACTCAGAAGGTGGA AGG Intronic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
905287417 1:36890575-36890597 CTGGTGGCTCAGTATGTGGAGGG + Intronic
905338342 1:37260612-37260634 TTGGAGCCCCAGAAGGTTGAGGG + Intergenic
905794355 1:40807274-40807296 CTGGAGAGTCACAAGGCGGAAGG + Intronic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
906994254 1:50773315-50773337 CTGCAGACTCAGAAGTGGGATGG - Intronic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
909317804 1:74246471-74246493 CTGGAAACTGAGAATGTTGATGG + Intronic
909872202 1:80755732-80755754 TTGGAGACTCAGGAGGTTGGGGG - Intergenic
909884168 1:80919908-80919930 CTGCAGACTGAGAAGTTCGAGGG + Intergenic
910442343 1:87265710-87265732 ATGGGGACTGAGAAGGTGGAAGG + Intergenic
910628892 1:89337074-89337096 CTGTGGATTCAGAGGGTGGAAGG + Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911182727 1:94875502-94875524 CAGGAGGCTCAGAAGGGGCAAGG - Intronic
911425686 1:97708083-97708105 CTGGCTACTCAGAAGGCTGAGGG - Intronic
911457797 1:98148905-98148927 TTAGAGACTCAGAAGGGGAAAGG + Intergenic
911795329 1:102068738-102068760 TTAGAGATTCAGAAGGGGGAGGG + Intergenic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
913241290 1:116832175-116832197 GAGGAGACTCAGAAGATGGTGGG - Intergenic
913452062 1:118999284-118999306 CTGCGGACTCAGTGGGTGGAGGG - Intergenic
913576250 1:120178075-120178097 TTAGAGACTTAGAAGGCGGAGGG - Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915098202 1:153478987-153479009 CTGGAGACTAGGGAGGAGGAAGG - Intergenic
915243835 1:154542585-154542607 CTAGAGACTGAGAAGTTGGAGGG + Intronic
915356067 1:155255684-155255706 CTGGAGCCTGAAAAGCTGGATGG - Intergenic
915565123 1:156708661-156708683 CTGGAGACTCAGTGAGGGGAGGG + Intergenic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916280956 1:163050776-163050798 CTGGTGACTCAGTAGCTTGAAGG + Intergenic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
916489704 1:165290825-165290847 CTTCTGACTCAGAAGGTGGGTGG - Intronic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916902779 1:169247640-169247662 TTGGCGACTCAGAAGAGGGAGGG - Intronic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
917505317 1:175622192-175622214 TTGGAGACTCTGAATCTGGAAGG + Intronic
917917569 1:179718878-179718900 CTGGAGACTCCAAAAGGGGAGGG - Intergenic
918002435 1:180510087-180510109 TTAGAGACTCAGCAGGGGGAGGG - Intergenic
918566880 1:185944302-185944324 TTGAAGACTCAGAAGGGAGAGGG + Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918922041 1:190725148-190725170 CTGTGTCCTCAGAAGGTGGAAGG + Intergenic
918928876 1:190826700-190826722 ATGGAGATTCAGAAGGGTGAGGG + Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919412527 1:197264130-197264152 ATGGAGACTTGGAAGGTTGAGGG - Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
920019675 1:202945849-202945871 ATGGAGACTTAGAAGCGGGAGGG + Intronic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
921773752 1:219073096-219073118 TTGGAGACTTGGAAGGTGGAAGG - Intergenic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922822322 1:228493140-228493162 CAGGAGGCTGAGAAGGAGGAGGG + Exonic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
922995053 1:229950307-229950329 GTAGAGACTCAGAAGCGGGAGGG - Intergenic
923180558 1:231514568-231514590 CTGGGGACTCCAAAGGTAGAAGG - Intergenic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923751194 1:236747496-236747518 GTGGAGGCTCAGAAGGGTGAGGG - Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
923880903 1:238103176-238103198 TTAGAGACTCAGCAGGGGGAAGG - Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924621992 1:245669971-245669993 TTGGAGACTCCGAAGGGGAAAGG + Intronic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1063856256 10:10257470-10257492 CTGGAAACATAGAAGTTGGAAGG - Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064921226 10:20521029-20521051 CCGGAGACTCAAAATGTTGAGGG + Intergenic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065319690 10:24497813-24497835 TTGGAGACTCAGAAGTGGGCAGG + Intronic
1065423677 10:25576202-25576224 CTGGAGACTCAGAAGGGGTTAGG - Intronic
1065699997 10:28415590-28415612 CTGGATACTACAAAGGTGGAAGG - Intergenic
1066173198 10:32874439-32874461 CTGGAGGCTCAGAAGGGGAGAGG - Intronic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1066994790 10:42553583-42553605 TTAGAGACTCAGAAGGGGGCTGG + Intergenic
1066995704 10:42561032-42561054 CTGGAGACTGAGATGCTGCAGGG - Intergenic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068189113 10:53627186-53627208 CATGAGCCTCAGAAGGTGAAAGG - Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068553280 10:58429594-58429616 ATGGAGACTCAGAAGAGTGAAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1068833615 10:61526666-61526688 CTGGAGACTCAGGAGGGTGCAGG + Intergenic
1068981744 10:63070012-63070034 CTGTAGACTCAGAAAATGGTTGG + Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1069460260 10:68588231-68588253 CTGCAGACTCACAAAGTGCAGGG + Intronic
1069486596 10:68827678-68827700 CTGGAGGCGCAGAAGGCGGCGGG + Exonic
1069486683 10:68828014-68828036 CTGGAGGCGCAGAAGGCGGCGGG + Intronic
1069607832 10:69750976-69750998 CTGGAGATTGATGAGGTGGAGGG + Intergenic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1070707063 10:78647514-78647536 CAGCAGACTCAGAAGATGGAAGG - Intergenic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071795738 10:89003128-89003150 GTTGAGACTCAGAACTTGGAAGG + Exonic
1072184011 10:93017249-93017271 CCAGAGACTCAAAAGGGGGAGGG + Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072475045 10:95751825-95751847 CTTGACACCCAGTAGGTGGATGG + Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1073790465 10:106934899-106934921 CTGGAAACTCAGAAAAGGGAGGG + Intronic
1073932942 10:108597794-108597816 CTGGAGATTCAGAAGGTACAGGG - Intergenic
1074210448 10:111328269-111328291 CTGGAGACTCCGAAGGGAGTGGG + Intergenic
1074298966 10:112216000-112216022 CTGGGAACTAAGAAGGTGTAGGG + Intergenic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1075093709 10:119457608-119457630 CTGGGGACTCAGTAGGGAGAAGG - Intronic
1075222890 10:120600267-120600289 CTGGAAAGTCACAAGGGGGATGG + Intergenic
1075690424 10:124390261-124390283 CTGGAGGCTCAGAGAGCGGAAGG - Intergenic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076171576 10:128324327-128324349 CTGGAGAGTCAGAAGTCAGAGGG - Intergenic
1076347583 10:129790391-129790413 TTAGAGACTCAGAAGCGGGAGGG + Intergenic
1076497441 10:130906155-130906177 CTCTGGACTCAGCAGGTGGAAGG - Intergenic
1077349629 11:2086450-2086472 CAGGGGACTCAGCAGGTGGACGG + Intergenic
1077439828 11:2562624-2562646 CTGGAGACTCTGAAGAGGGGTGG - Intronic
1077546185 11:3171028-3171050 CTGCAGACCCCGCAGGTGGAGGG + Intergenic
1078019246 11:7641476-7641498 CAGGAGACACAGAAAGTGGCTGG + Exonic
1078106537 11:8361473-8361495 CTGGAGAGTGAGCAGGTGGGTGG - Intergenic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079252897 11:18800409-18800431 CTGGAGACTTGGAAGGGTGAAGG + Intergenic
1079467799 11:20748563-20748585 TTGGAGACTGAGAAGGCAGAAGG - Intronic
1079536590 11:21522548-21522570 ATGGAGACTCTGAAGGTGTGCGG + Intronic
1079812812 11:25016308-25016330 TTACAGACTCAGAAGGGGGAAGG - Intronic
1079879842 11:25913012-25913034 CTGGAGACTCAAAAGTGGGAAGG + Intergenic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082202983 11:49396303-49396325 TTTGAGACTCAGAAGGTGGGAGG - Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083420025 11:62547157-62547179 CTGGGGGCTCTGAAGGTGGCTGG + Intronic
1083777926 11:64903240-64903262 CTGGAGCCACAGCAGGTGCAGGG - Intronic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1084457473 11:69276640-69276662 CTTGAGAGGCAGAAGCTGGAGGG - Intergenic
1084740527 11:71136475-71136497 CAGGAGACTCAGAAGGGTGGTGG + Intronic
1085715909 11:78873091-78873113 CTGGAGACTGGGAAGCTGTAGGG - Intronic
1085886334 11:80526724-80526746 CTGGAGACCCAGAAGAGGGGAGG + Intergenic
1086049252 11:82569328-82569350 ATGGAAGCTCAGAAGGGGGATGG - Intergenic
1086445602 11:86867546-86867568 CTAGGGTCTCAGAAGGAGGATGG - Intronic
1086652048 11:89303776-89303798 TTTGAAACTCAGAAGGTGGAAGG + Intergenic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1087518745 11:99201737-99201759 CTGCTGACTCTGAAGATGGAAGG + Intronic
1087771973 11:102220657-102220679 CTGGAGTCTCTGAGGTTGGAGGG + Intronic
1088603524 11:111506467-111506489 CTGGGGACTCCAAAGGTGGGTGG + Intronic
1088705812 11:112463728-112463750 CTGGAGTCTGGGAAGGTAGAAGG - Intergenic
1088779945 11:113124206-113124228 CTCTAGACTGAGAAGGAGGAAGG + Intronic
1088793629 11:113248748-113248770 GTGGCGACTCAGAAGGAGAAGGG + Intronic
1089102325 11:115973952-115973974 CTGGAGTCACAGAAACTGGATGG - Intergenic
1089189483 11:116643765-116643787 CTGGCCACACAGAAGGTGGGTGG + Intergenic
1089440668 11:118514105-118514127 CTGGAGACTCTGAGGGTACAAGG - Intronic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091045184 11:132318837-132318859 CTGTAGACTTTGGAGGTGGAGGG + Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094166887 12:27452350-27452372 ATGGAGACTCAGGAGGGTGAAGG - Intergenic
1094322101 12:29195858-29195880 ATGGGGACTCAGAAGGACGAGGG - Intronic
1094816512 12:34191756-34191778 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1095458169 12:42412250-42412272 ATGGAGACTCACAAGCAGGAGGG - Intronic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1096001629 12:48135086-48135108 CAGGAGACTCAGAAGCCAGAAGG - Intronic
1097178335 12:57156467-57156489 CTGGAGGCTGAGTGGGTGGATGG - Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097477657 12:60078625-60078647 TTGGAGACTCAGAAGGGGATAGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099164156 12:79281519-79281541 CTGGAGACTCAAAAGTGGGAAGG + Intronic
1099344044 12:81475815-81475837 CTGGAGGCTGAGAAGGAGAATGG - Intronic
1099355119 12:81624812-81624834 TCAGAGACTCAGAAGGGGGAGGG + Intronic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100008610 12:89925048-89925070 CTAGCGATTCAGAAGGTGGAAGG - Intergenic
1100027704 12:90150199-90150221 CTGGAACCTCACATGGTGGAAGG - Intergenic
1100292076 12:93225309-93225331 TTGGAGACTAAGAAGAGGGAAGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101242016 12:102848344-102848366 CAGGAGACTGAAGAGGTGGAGGG + Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101928713 12:108994693-108994715 CTGGAGACTCTGAAGTCAGATGG - Intronic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102897308 12:116608953-116608975 CTGGAGACTCAGAAGCGGGGCGG + Intergenic
1103105680 12:118222761-118222783 TTGGAGACTCAGAAGAGGAAGGG + Intronic
1103179038 12:118891709-118891731 CTGAAGACTAGGAAGGAGGATGG + Intergenic
1103277746 12:119727437-119727459 CTGTGGATTCAGAAGGGGGAAGG + Intronic
1103301150 12:119927426-119927448 CTGCATCCTCAGACGGTGGAAGG - Intergenic
1103449187 12:121016258-121016280 CTGGAGCCTGAGAGGATGGATGG - Intronic
1104177613 12:126348201-126348223 CTGGAGACTCGAAGGGAGGAAGG - Intergenic
1104244449 12:127024313-127024335 TTAGAGACTCTGAAGGAGGAAGG + Intergenic
1104291620 12:127474544-127474566 CTAGAGACTCTGGAGGTGGCTGG - Intergenic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1104942047 12:132399767-132399789 CTGGAGACTCAGGCGTTGGAGGG - Intergenic
1105508787 13:21034214-21034236 CCTGAGGCTCAGAAGGTGCATGG + Intronic
1105592263 13:21803604-21803626 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106068915 13:26387730-26387752 GTGGAGACCTAGAAGATGGAAGG - Intronic
1106338386 13:28805505-28805527 TTGGCCACTCAGAAGGTGAATGG - Intergenic
1107773535 13:43813449-43813471 ATGGAGACTCAGAGGCTGGGTGG - Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108096691 13:46909118-46909140 CTGGAGACTCAGAAGTGAGGAGG - Intergenic
1108404560 13:50086995-50087017 TTGCTGACTCTGAAGGTGGAAGG + Intronic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108822425 13:54369604-54369626 TTGGAGGCTCAGAAGGGAGAGGG - Intergenic
1108875948 13:55051301-55051323 CTGGAGATTCAGAAGAGAGAAGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109483629 13:62990278-62990300 TTGGAAACTCAGAAGGGAGAGGG - Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1110682084 13:78326003-78326025 CTTTAAACTCAGAAGGTGAATGG + Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112694110 13:101928124-101928146 CTGGACACTCTGCATGTGGAAGG + Intronic
1113050290 13:106203835-106203857 TTGGAGACTCAGAGGGGGAAGGG - Intergenic
1113059250 13:106303501-106303523 CAGAAGACTGAGCAGGTGGAGGG + Intergenic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114451719 14:22830794-22830816 CTGGAGTCTCATAAGGAGAATGG - Intronic
1114489672 14:23091480-23091502 CTGGCTACTCAGGAGGTGGTGGG + Intronic
1114648809 14:24270325-24270347 CTGGAGACTCAGAAGTGCGTAGG - Exonic
1114661987 14:24352609-24352631 TTGGAGACTCAGATGTGGGAAGG + Intergenic
1114949904 14:27736994-27737016 CTGGCCACTCATAGGGTGGAAGG + Intergenic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116693851 14:48147220-48147242 CTGGAGACTCAGAAGGGCAGAGG + Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1116762786 14:49035343-49035365 CTGGAGATTCAGAAGGGTGGGGG + Intergenic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1117517965 14:56521377-56521399 TTGGAGAGTTAGAAGGGGGAGGG - Intronic
1117640501 14:57793399-57793421 TTGGAGGCTCAGAAGGTAGAAGG - Intronic
1117740135 14:58809526-58809548 ATGGAGTCTCAGAAGGGTGAGGG - Intergenic
1117749717 14:58908613-58908635 CTGGAGACTTGGAAGGGTGAGGG + Intergenic
1118010927 14:61609738-61609760 CTGGAGACACAGCAGAGGGAAGG - Intronic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1118586042 14:67354049-67354071 CTGGAGGCTGAGAAGGGTGAGGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1120139588 14:80913755-80913777 GTGGAGACTCAGAAGGGAGGAGG + Intronic
1121739822 14:96243463-96243485 CTGGAGAGCCAGAACCTGGAGGG + Exonic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122414417 14:101542030-101542052 CTGGAGGCTGAGCGGGTGGAGGG - Intergenic
1122638026 14:103139229-103139251 CAGGAGACTCCGCAGGAGGAAGG + Intergenic
1122879514 14:104683847-104683869 CTGCAGACTCAGAAGAGGCAGGG - Intergenic
1124100695 15:26690083-26690105 CTGGAGAATGAGAAGGTACACGG + Intronic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1124800062 15:32823878-32823900 CTGCGAACTCACAAGGTGGAAGG + Intronic
1125987397 15:44067580-44067602 CTGCATCCTCAGAGGGTGGAGGG + Intronic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126382147 15:48059960-48059982 CTGGAGTCTCAGGACGGGGAGGG - Intergenic
1126413821 15:48397714-48397736 GTGGTGGCTCAGAAAGTGGAAGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126549952 15:49917624-49917646 CTGGAGAATCAGATGGTGTTGGG + Intronic
1126584024 15:50265653-50265675 ATGGACACGCAGGAGGTGGAAGG + Exonic
1126715864 15:51516795-51516817 TTAGAGACTCAGAAGAGGGAGGG - Intronic
1127449526 15:59103277-59103299 TTAGAGACTCAGAAGAGGGAGGG - Intergenic
1128323689 15:66709445-66709467 CCTGGGACTCAAAAGGTGGAAGG - Intronic
1128733598 15:70036957-70036979 CAGGAGGGTCAGCAGGTGGAGGG - Intergenic
1128965132 15:72051337-72051359 CTGTCAACTCAGAAGGTGGCAGG - Intronic
1129253877 15:74323054-74323076 CTGGAGACTTAGAAGGTAAGAGG - Intronic
1129410950 15:75349962-75349984 CAGGAGGCTAAGAAGGTGGAGGG + Intronic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130517819 15:84639698-84639720 CTGGAGGATGAGAAGGTGGCAGG + Exonic
1130542724 15:84833484-84833506 CTGGAGAGGTGGAAGGTGGATGG + Intronic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1130960421 15:88655244-88655266 TAGGAGACTCAGCAGGTGGCTGG - Intronic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1132170676 15:99650853-99650875 CTGCAGATTCAGAAGGTCTAAGG - Intronic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133062560 16:3184067-3184089 CAGGAGACTAGGAAGGCGGAGGG - Intergenic
1133063099 16:3188209-3188231 CAGGAGACTAGGAAGGCGGAGGG + Intergenic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133681181 16:8121645-8121667 CTGGGAACCCAGGAGGTGGAGGG - Intergenic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133886942 16:9838894-9838916 CTGGAGACTCAGAAAGGGAGAGG + Intronic
1133922189 16:10163286-10163308 CACCAGGCTCAGAAGGTGGAAGG + Intronic
1134740667 16:16540914-16540936 CTGGAGACTCAGAAGAGGAGAGG - Intergenic
1134926835 16:18171266-18171288 CTGGAGACTCAGAAGAGGAGAGG + Intergenic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135407759 16:22210223-22210245 CTCCAGAGTCAGAAGGTGGATGG + Intronic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136651103 16:31672076-31672098 TTAGAGACTTAGAAGGGGGAGGG - Intergenic
1137565866 16:49532224-49532246 CTGGAGACTCTGACGGTGGGTGG + Intronic
1137902873 16:52288044-52288066 CTGAAGACCCAGAAATTGGATGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138135128 16:54514855-54514877 CCGGAGACTTAGAAGGTGGATGG - Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138492753 16:57385929-57385951 CAGGAGATCCAGGAGGTGGAGGG - Intergenic
1138515070 16:57531403-57531425 CTGTGGACAAAGAAGGTGGATGG - Intronic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1138938956 16:61766146-61766168 TTGGAAACTCAGAAGGGGGTAGG - Intronic
1139023924 16:62789939-62789961 TGAGAGACTCAGAAGGGGGAGGG - Intergenic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1140420826 16:74817450-74817472 CTGGTGCCTTAGAAGGTGGATGG + Intergenic
1140514468 16:75532163-75532185 GGGGAGACTCACCAGGTGGAGGG - Intronic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141149103 16:81551995-81552017 CTGCAGAGTCACCAGGTGGAAGG - Intronic
1141786892 16:86207008-86207030 CTGGTTACTCAGGAGGTTGAGGG + Intergenic
1142005125 16:87686050-87686072 CTGGAGACTCCGTGGCTGGAGGG + Intronic
1142018508 16:87765598-87765620 GTGGAGACTCAGGAGGGGGCGGG + Intronic
1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG + Intergenic
1142145848 16:88492664-88492686 GTGGACATCCAGAAGGTGGACGG + Intronic
1142687040 17:1583339-1583361 GTGGAGACACAGAACGTGCAGGG + Intronic
1143374468 17:6459074-6459096 CAGGTGAATGAGAAGGTGGAAGG - Intronic
1144136700 17:12302117-12302139 CTGGAGACCGAGAAGGAGAATGG - Intergenic
1144951306 17:18995514-18995536 TTGCAGTCTCAGAAGGTGGAAGG + Intronic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146460738 17:33044339-33044361 TTGGACACATAGAAGGTGGATGG - Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1147504997 17:41007159-41007181 TTAGAGACTCAAAAAGTGGAGGG + Intergenic
1148324505 17:46775420-46775442 CTGGAGACAACCAAGGTGGATGG - Intronic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148455513 17:47809064-47809086 CTGGAAACCCAGTAAGTGGAGGG - Exonic
1148798709 17:50210055-50210077 CCTGAGGCCCAGAAGGTGGAGGG + Intergenic
1149217096 17:54370216-54370238 CTGGGGAGTTAGAAGGGGGATGG + Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149436923 17:56640854-56640876 ATGGAGAGTCAGTAGGTGAACGG + Intergenic
1150665319 17:67130165-67130187 CTGGAGATTCAGAAGGTAGCGGG + Intronic
1151391767 17:73791916-73791938 CTAGAGGCTCAGCAGCTGGAGGG + Intergenic
1152102395 17:78309736-78309758 CTGCTGACTTTGAAGGTGGAGGG + Intergenic
1152140483 17:78533616-78533638 CTGGAGAATCCCAAGGTGGTCGG + Intronic
1152283518 17:79399137-79399159 CTGGAGTCTCAGAGGGGGCATGG + Intronic
1153350835 18:4079521-4079543 CTGGAGACTCAGAAGTGGGGAGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153464335 18:5372228-5372250 CTGTAGGCTCACAGGGTGGAAGG - Intergenic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154138898 18:11805513-11805535 CAGGAGACTCAAAAGGGTGAGGG - Intronic
1154214961 18:12408739-12408761 ATGGAGACTCTGAAGGGTGAGGG + Intronic
1155087290 18:22470980-22471002 CTGGAGCCCCAGAAGCTGGCTGG + Intergenic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156279162 18:35616845-35616867 CTGAAGAGTCAGAAGTTTGAGGG - Intronic
1156490916 18:37495523-37495545 CTGGAGCCTCAGATGGGGCATGG - Intronic
1157394702 18:47331860-47331882 AAGCAGACTCAGAAGCTGGAAGG - Intergenic
1157555218 18:48609081-48609103 CTGTGGACTCTGAAGGTAGATGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158729181 18:60003803-60003825 CTGGAGACAGGGAAGCTGGACGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1158867777 18:61654551-61654573 ATGGAGTCTCATAAGGTAGAGGG + Intergenic
1159794214 18:72822228-72822250 CTCAAGTCTCAGAGGGTGGAGGG + Intronic
1160213815 18:76908492-76908514 CTGGAGCCTCAGCATGTGGTGGG + Exonic
1160239427 18:77112559-77112581 CTGGAAACAGAGAAGGGGGAGGG - Intronic
1160331894 18:78001281-78001303 TTAGAGACTCAGAAGGGGAAGGG - Intergenic
1160345550 18:78129120-78129142 CTGGAGCCCCAGAAGCTGGAGGG + Intergenic
1160427490 18:78788129-78788151 CTGCAGAGCCAGGAGGTGGATGG - Intergenic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1161530176 19:4784106-4784128 GTGGAGACTCAGAAGCGGGGAGG + Intergenic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1163162716 19:15475151-15475173 GTGGAGATTCAGAAGGGTGAGGG + Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164773295 19:30830039-30830061 TTGGATACTCAGAAGGTAGGAGG - Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1164944595 19:32282757-32282779 CTGGAGACTCAAAAGGGGAGAGG - Intergenic
1165230312 19:34382635-34382657 CTGGAGCCTGAGCAGGTGGTGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167348730 19:48962445-48962467 CTGGCGACTGAGAGGCTGGAGGG + Intergenic
1167484979 19:49757441-49757463 CTGAAGACTCAGAAGGTCTTGGG + Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1168254725 19:55159145-55159167 CTGGAGACTCAGAGGGCAGCTGG + Exonic
925029765 2:641343-641365 CTGGAGACTCAACAGGCAGACGG + Intergenic
925144334 2:1570779-1570801 CTGGAGACTCAGAGGCGGGGAGG - Intergenic
925152676 2:1625995-1626017 CAGCAGACTCACAAGGTGGACGG + Intergenic
925654105 2:6126303-6126325 CTGGAGAGCCAGGAAGTGGATGG + Intergenic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
926384196 2:12319841-12319863 CTGGAGATGAAGTAGGTGGAGGG + Intergenic
926577544 2:14598706-14598728 CTGGAGACTCAGGAGATGGTAGG - Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
927012582 2:18920873-18920895 CTGGAGACTCCAAAGATGGGAGG - Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927277012 2:21270973-21270995 CTGGAGGTGCAGAAGCTGGAGGG - Intergenic
927855824 2:26527471-26527493 CTGGAGAGGCGAAAGGTGGAGGG - Intronic
927927401 2:27023589-27023611 CTGGAGAGTCGGGAGGTGGAGGG - Intronic
928220427 2:29398691-29398713 CTGGAAACTGGGAAGGAGGAGGG - Intronic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
928761110 2:34584081-34584103 TTGGAGACTGAGAAGTGGGAAGG + Intergenic
929575208 2:43047346-43047368 CTGGAGACCCGGAAAGTGGGAGG - Intergenic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
930539442 2:52686754-52686776 CTGGAGTCTCAGAATGGGGGAGG + Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
932875062 2:75442793-75442815 TTGGAGATTCAGAAGTGGGAAGG + Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933595729 2:84281520-84281542 CTGAACACTCAGTAGGTGGCCGG + Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
933997886 2:87683312-87683334 ATGCACACTCACAAGGTGGATGG - Intergenic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
935081085 2:99795373-99795395 CTGGGGACTCAGAAGGGCAATGG + Intronic
935329381 2:101965360-101965382 CTGGAAACTCTGGAGGTGGGTGG + Intergenic
936295965 2:111267554-111267576 ATGCACACTCACAAGGTGGATGG + Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936596819 2:113856012-113856034 ATGAAGATTCAGAAAGTGGAAGG + Intergenic
937987059 2:127642676-127642698 CTTGAGACTCAGGAGGCGGGTGG - Intronic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
939027417 2:137030758-137030780 CTGGAGACTCAGAAATGGGGAGG + Intronic
939106173 2:137951166-137951188 TTGGAGACTCAGAAGTGGAAGGG - Intergenic
939489291 2:142857467-142857489 CTGGAGGCTGAGGAGGAGGATGG + Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940605545 2:155919547-155919569 CTGGAGACTTAAAATGTGAATGG - Intergenic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
941478886 2:165981826-165981848 CTGGAGATTCAGAAGTAGGGAGG - Intergenic
942166303 2:173244118-173244140 CTGGAGACGCAGCAAGTGGGAGG + Intronic
943322624 2:186464447-186464469 TTAGAGACTCAGAAGTAGGAGGG + Intergenic
943341359 2:186685736-186685758 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
944082401 2:195802859-195802881 GAGGAGACTCAGAAGGGTGAAGG - Intronic
944743474 2:202634648-202634670 CTGGGGACTCAGACTCTGGAAGG - Intergenic
945075774 2:206038066-206038088 ATGAAGACTCAGAAGGGTGACGG + Intronic
945327680 2:208501550-208501572 CTAGAGACTCAGAAAGGGGGAGG - Intronic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946536956 2:220640937-220640959 CTGGAGTCTCTGAAGGAGTAAGG + Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
947131508 2:226931477-226931499 TTTGAGACTCAGAAGGGGAAAGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
948907632 2:240987249-240987271 CTGGAGCCTGAGGAGGGGGAGGG + Intronic
948917520 2:241042897-241042919 CTGGAGTCTGCGAAGGAGGATGG + Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169191687 20:3662163-3662185 CTGGAGACAGAGAAGGTGCCTGG + Intronic
1169198650 20:3697040-3697062 CTGGGGACTTGGAGGGTGGAGGG - Intronic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169416576 20:5422345-5422367 TTAGAGACTCAGAAGCTGGAGGG + Intergenic
1169421829 20:5466601-5466623 CTTGAGACTGAGAAGGTGCAGGG - Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1170661526 20:18345844-18345866 CCAGAGACTCAGGAGGAGGAAGG + Intergenic
1170766000 20:19290499-19290521 CTCTAGCCTCACAAGGTGGAAGG - Intronic
1170809195 20:19660292-19660314 TTGGAGACTTAGAAGGTGGGGGG - Intronic
1171042073 20:21773917-21773939 CTGCAGACTCAGAAGGTGGGAGG - Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171374537 20:24683374-24683396 CTGGAGACTCAGAACGGTGGGGG + Intergenic
1171778495 20:29394603-29394625 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1171822552 20:29867053-29867075 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1172056091 20:32155278-32155300 CTGGGGACTCAGAAAAGGGAAGG - Intronic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173433005 20:43008286-43008308 CTGGAGCTTCACATGGTGGAAGG - Intronic
1174439731 20:50540956-50540978 CTAGGGACTGAGCAGGTGGATGG - Intronic
1174785887 20:53432128-53432150 CTGGAGACTCAGAAGTGGGGAGG - Intronic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175255266 20:57641156-57641178 CTGGGAACTCATATGGTGGAAGG - Intergenic
1175343785 20:58254523-58254545 CTGAAGACTCAGAAGGGGAGAGG + Intergenic
1175529639 20:59665730-59665752 CTGGAGGCTCAGGAGATGAAGGG + Intronic
1175614703 20:60387407-60387429 CTAGAGACTGGGAAGGGGGAAGG + Intergenic
1176097883 20:63352632-63352654 TTTGTGCCTCAGAAGGTGGAGGG - Intronic
1176255820 20:64152414-64152436 CTGCAGACTCAGAGGGTCCAAGG + Intronic
1176292748 21:5054991-5055013 CTGGATCCTCAGGATGTGGATGG - Intergenic
1176425112 21:6543881-6543903 CTGGAGGCTGAGAAGTTGGCAGG - Intergenic
1176937274 21:14881980-14882002 CTGTATACTCACATGGTGGAAGG + Intergenic
1177378921 21:20312538-20312560 CTGGAGACTTAGAAGGTGGGAGG + Intergenic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1179318350 21:40267012-40267034 CGGGAGACTCAGAAGTGGGGAGG + Intronic
1179419390 21:41223432-41223454 CTGGAGTCTCAGAGGATGCATGG - Intronic
1179700603 21:43152198-43152220 CTGGAGGCTGAGAAGTTGGCAGG - Intergenic
1179791636 21:43759320-43759342 CTGGAGCCAGGGAAGGTGGACGG - Exonic
1179864512 21:44208659-44208681 CTGGATCCTCAGGATGTGGATGG + Intergenic
1180226758 21:46398056-46398078 CAGGAGATTCAGAGGCTGGAGGG + Exonic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1181362923 22:22352762-22352784 CTGCAGACTAAGCAGGAGGAAGG - Intergenic
1181365730 22:22375835-22375857 CTGCAGACTGAGCAGGAGGAAGG - Intergenic
1181673851 22:24439362-24439384 AGGGACACTCAGAAGGTGCAAGG - Intronic
1181847057 22:25719305-25719327 CTGGACAGTTAGGAGGTGGAAGG + Intronic
1181906406 22:26200674-26200696 CTGGAGGCTGAGAAGGCTGATGG - Intronic
1182060661 22:27394849-27394871 CTGGATACTGGGTAGGTGGATGG + Intergenic
1182208144 22:28649196-28649218 TTGGAGACTCAGGAGGTAGGAGG + Intronic
1182468471 22:30532517-30532539 CTGCAGAGTCAGAAGGTGTGTGG - Exonic
1182566773 22:31206002-31206024 CTGGAGACCCCAAAGCTGGAGGG + Exonic
1183392317 22:37552526-37552548 CTGGAGAGCAAGAAGTTGGAGGG - Intergenic
1183411985 22:37660264-37660286 GTGGGGACACAGGAGGTGGAGGG - Intronic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1183896958 22:40977159-40977181 CTGGAGCCTCAGAACCAGGAGGG + Intergenic
1184355761 22:43978577-43978599 GTGAAGACTCAGAAGGTCCACGG - Intronic
1184477331 22:44728827-44728849 CTGGAGGCTGAGAAGGGGCAGGG - Intronic
1184816729 22:46877879-46877901 AAGGAGACTCGGAAGGTCGATGG + Intronic
1184967918 22:47995217-47995239 CTGGAGCCCCAGCAGCTGGAAGG - Intergenic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
1185282126 22:49977001-49977023 CTGGCTACTCAGGAGGTGGCTGG - Intergenic
949696927 3:6708372-6708394 ATGGAGACTCAGAAATTGAAAGG - Intergenic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
950456768 3:13097369-13097391 CTGGAGACTCAGTGACTGGAGGG - Intergenic
951008409 3:17646900-17646922 CTGGGGACTCAAAAAGTGGGAGG - Intronic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
951500539 3:23381895-23381917 ATGTAGACTGAGAAGGTGGGAGG + Intronic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952440860 3:33327237-33327259 CTGGAGGCTCAAAAGTTGAATGG + Intronic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952749202 3:36811533-36811555 TTAGGGACTCAGAAGGTGGAGGG + Intergenic
953058146 3:39404791-39404813 GTGAACACTCAGAGGGTGGAGGG + Intergenic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953445051 3:42956315-42956337 CTGTGTACTCAGAAAGTGGAAGG + Intronic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955060774 3:55489726-55489748 ATGGAGACTCAGGAGGTAAAGGG - Intronic
955123390 3:56084690-56084712 TTGGAGACTTAGAAGCAGGAAGG + Intronic
955241938 3:57186064-57186086 CTGGAGACTCTGGAGGAGCAGGG - Intergenic
955457561 3:59140617-59140639 CTGGAGACTCAGGAGTGGGGAGG + Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955698830 3:61663305-61663327 CTGGTGTCACAGAACGTGGAAGG + Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956314503 3:67919515-67919537 TTGGAGACTCTGAAAGTGGGAGG - Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956419991 3:69077867-69077889 CTGGAGACTGGGAAGGTCGCTGG - Exonic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
956737343 3:72247828-72247850 CTGGAGACTGAACAGCTGGATGG + Intergenic
956856093 3:73276273-73276295 TTGGAGACTCAGAAGTAGGCTGG - Intergenic
956992366 3:74781889-74781911 TTGAAGACTCAGAAGCTGGGAGG + Intergenic
958665176 3:97128014-97128036 CCGGAGACTCAGAAGTGGGGAGG - Intronic
958859930 3:99434354-99434376 TTGGTGACTCAGAAGGAGAAGGG - Intergenic
958986471 3:100784868-100784890 TTAGAGACCCAGAAGGGGGAGGG + Intronic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960414953 3:117373246-117373268 TTGGATACTCAGAAGGTAGAGGG - Intergenic
960639478 3:119812336-119812358 CAGGAGACTCAGAAGGTTTAGGG - Intronic
961235072 3:125359185-125359207 CTGGAGACTCAGAGTGTTGAAGG - Intronic
961621806 3:128230258-128230280 CTGGCTACTCTGAAGGTTGAAGG - Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961732507 3:128976619-128976641 CTGGAGACTCAGGAGTCTGAAGG + Intronic
961817496 3:129558813-129558835 CTGGAGGCTCAGGAGGGGGTTGG - Intronic
961955577 3:130799608-130799630 TCAGAGACTCAGAAGGAGGATGG + Intergenic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962250939 3:133835790-133835812 CTGCATCCTCACAAGGTGGAAGG - Intronic
962704961 3:138034139-138034161 ATGGAGACTCAGAAAGTTTAAGG - Intergenic
963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG + Intronic
963727695 3:148940340-148940362 CTGGCTACTCAAAAGGTTGAAGG + Intergenic
964074805 3:152680761-152680783 CTGGAGAATAAGAAGATAGAAGG + Intergenic
964629423 3:158794085-158794107 GTAGAGACTCAGAAGGGTGAAGG - Intronic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
965255771 3:166408823-166408845 CAGGTGACTCAGAAGGTTGCTGG - Intergenic
967081026 3:186049597-186049619 CTGGAGACGCAGAGGGGGAAGGG + Intronic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
967699119 3:192571004-192571026 CTGAAGAATCAGAAGGTTAATGG - Intronic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968124856 3:196151521-196151543 CTAGAGCCTCAGAAGGAGCATGG - Intergenic
968153179 3:196355816-196355838 CTGCAGACTCAGACAATGGAGGG + Exonic
968292861 3:197552470-197552492 ATGGAGACCCAGAACATGGAGGG - Intronic
968490207 4:886056-886078 CTGGAGGCTCAAAAGATGGCTGG - Intronic
968857548 4:3138394-3138416 TTGGAGACTCACAAGGCGGAAGG - Intronic
969405212 4:6987116-6987138 CTGGAGACTCCCAAGGGGGCGGG - Intronic
969897174 4:10316274-10316296 TTGGAGACTCAGAAGGGTCATGG - Intergenic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970559063 4:17265182-17265204 CTGCATCCTCACAAGGTGGAAGG + Intergenic
970616858 4:17775832-17775854 CTGGAGACTCCAAGGGTGGGAGG + Intronic
970659069 4:18264251-18264273 CTGGAGACACAGAGAGTGAAGGG + Intergenic
971519886 4:27536202-27536224 TTGCAGACTCAGAAGGTGAGAGG - Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
972446038 4:39144713-39144735 CTGGAGACTCAGAAATGGGGAGG - Intergenic
972805009 4:42520538-42520560 ATGGAGAGCGAGAAGGTGGAGGG + Intronic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
973840843 4:54858881-54858903 ATGGTAGCTCAGAAGGTGGAAGG + Intergenic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974837192 4:67265297-67265319 AGGGAGACACAGAAGGTGGGTGG - Intergenic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975437445 4:74369307-74369329 TTAGAGACTCAGAAGGGGAAGGG - Intronic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977692355 4:99928334-99928356 GTGGAGACATAAAAGGTGGAAGG - Intronic
977707636 4:100088998-100089020 CTGGAGACTCAGAACGGGAAGGG - Intergenic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978002450 4:103573009-103573031 TTTGAGTCTTAGAAGGTGGATGG + Intergenic
978383564 4:108156838-108156860 GTAGAGACTCAGAAGGGTGAGGG + Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
979663850 4:123289172-123289194 CTGGAGATTCAGAACGGGGTAGG - Intronic
979847249 4:125531349-125531371 CAGGAGGCTGAGAAGTTGGAAGG - Intergenic
980848136 4:138348774-138348796 TTAGAGACACAGAAGGAGGAAGG + Intergenic
980963800 4:139501419-139501441 TCAGAGACTCAGAAGGGGGAGGG + Intronic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981381410 4:144076245-144076267 TTGGAGACTCAGAAGCGGGTGGG - Intergenic
981529024 4:145734337-145734359 GAGGACACTCAGAAAGTGGAGGG + Intronic
981738491 4:147977815-147977837 CTGGAGACTCCAAAAGGGGAGGG - Intronic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
981904118 4:149901004-149901026 CTAGCGACTCAGTAGGGGGAGGG + Intergenic
981954602 4:150454737-150454759 TTGGAGACTTAGAAGGGAGAAGG - Intronic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983511144 4:168610706-168610728 TTGGAGAGCCAGAAGGTGGTTGG - Intronic
984232831 4:177120046-177120068 CTGTAGATTTAGAAGATGGATGG - Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
985042839 4:185909366-185909388 TTGGAGACTCAGAAGGGCTAGGG + Intronic
985112584 4:186561199-186561221 CTGGGTACTCAGGAGGTTGAGGG + Intergenic
985655118 5:1127424-1127446 CTGGAGCCGCAGAAGTTGGAAGG + Intergenic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
986435845 5:7730038-7730060 ATGGAGACTCCAAAGGGGGAAGG - Intronic
986438636 5:7759345-7759367 CTGGAGGCTGAGCAGGTGGCTGG - Intronic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986958341 5:13183381-13183403 ATGGAGATTCAGAGGGTGGGAGG - Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988774390 5:34464082-34464104 GTGGAGTCACAGAGGGTGGAAGG + Intergenic
988821230 5:34888129-34888151 CTGTAAACTCACATGGTGGAAGG - Intronic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989443432 5:41500411-41500433 ATGGATACTCAGAAGGGTGAGGG + Intronic
989534024 5:42542788-42542810 CTGGAGACTGAGGAGGGGGTAGG - Intronic
989574159 5:42973606-42973628 CTGGAGCCATTGAAGGTGGATGG - Intergenic
989607539 5:43258928-43258950 TTGGAGACTTAGAAGGGGTAGGG - Intronic
990232521 5:53729129-53729151 CTGTAGTCCCAGAAGGTGGAGGG + Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992276388 5:75124803-75124825 CTGGAGACTCAGAAGGGTAGGGG + Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992738889 5:79753011-79753033 TTGGAGATTGAGGAGGTGGAAGG + Intronic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
994051494 5:95367173-95367195 CTGGAGACTAGGAAGGTGGTGGG - Intergenic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
994313544 5:98305497-98305519 TTGAAGACTCAGAAGTGGGAAGG + Intergenic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
995412266 5:111872169-111872191 CTGGAGACCCAGAGAGTTGATGG + Intronic
996620413 5:125495036-125495058 TTAGAGACTCAGAAGGGGAAGGG + Intergenic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
999068544 5:148717497-148717519 CAGGAGAGGCAGAAGGTGAAGGG - Intergenic
999471311 5:151857578-151857600 CTGGACACCCAGAAGGCAGAGGG - Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
1000593099 5:163182415-163182437 CAGCAGACTCATAGGGTGGAGGG - Intergenic
1000614888 5:163415769-163415791 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1000641073 5:163702265-163702287 TTAGAGACTCAGAAGGGTGAAGG - Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001325925 5:170723989-170724011 CAGCAGAGTCAGATGGTGGAGGG + Intronic
1001760882 5:174207150-174207172 TTGGAAACTCAAAAGGGGGAGGG + Intronic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1002996931 6:2295278-2295300 TTGGAGACTGACAAGGGGGAGGG + Intergenic
1003993830 6:11517627-11517649 CTGGAGACTGTAAAGGTGGGAGG + Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004464029 6:15866776-15866798 CTGGAGCCTCAGAGGGTGTTGGG - Intergenic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006664343 6:35679758-35679780 CTAGAGACTCAGAAGAGGGCAGG + Intronic
1007040357 6:38715747-38715769 TCGGAGACTCAGAAGGGGAAGGG + Intronic
1007412785 6:41674606-41674628 CAGGAGACTCTGAAAGTGGAAGG - Intergenic
1007941994 6:45789992-45790014 CTTGAGGCTGAGAAGGTGGAAGG + Intergenic
1008595277 6:53035785-53035807 CTGCTGACTCAGAAGGGGAAGGG - Intronic
1008845913 6:55964015-55964037 CTTCAGAATCAGAAGGTGGCAGG - Intergenic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009347916 6:62639554-62639576 ATGGAGACTCAGACCGTGTAGGG - Intergenic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1010412786 6:75579685-75579707 CTGGATTCTCACAAGTTGGAGGG - Intergenic
1010742287 6:79522793-79522815 CTGGCTACTCAGGAGGTGGGAGG - Intronic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011308188 6:85952511-85952533 CGGGAGACACAGAAGGGGAAGGG - Intergenic
1011626029 6:89284609-89284631 CAGGAGCCACAGAATGTGGACGG + Intronic
1011664995 6:89624774-89624796 CTGGACACTCCCAGGGTGGAAGG - Intronic
1011713467 6:90079214-90079236 CTGTAGACACAGATGTTGGAGGG - Intronic
1012029560 6:94041066-94041088 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1012729698 6:102866682-102866704 TTGGAGACTCAAAAGGGGAAAGG + Intergenic
1012896311 6:104953657-104953679 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1012902344 6:105020708-105020730 ATAGAGACTCAGAAGGGTGAGGG - Intronic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1013847534 6:114471938-114471960 CTGGAGAGACAGAAGCTGGTAGG - Intergenic
1013957861 6:115861395-115861417 CTGTGGACTCATATGGTGGAAGG + Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015607757 6:134976738-134976760 CTGGAGACTCAGTAGCGGGTAGG + Intronic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1015812878 6:137178921-137178943 ATGGAGACACAGTAGGTGCAGGG + Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016409339 6:143765571-143765593 CTGGAGCCACAGGGGGTGGAGGG - Exonic
1016469082 6:144356074-144356096 CTGGAACCTCAAAAGGGGGAAGG + Intronic
1016540382 6:145157872-145157894 CTGTATCCTCACAAGGTGGAAGG - Intergenic
1016622454 6:146128007-146128029 CTGGAACCTCAGAATGTGGCTGG + Intronic
1016689563 6:146921169-146921191 CTGGAAACTCAGAAGGGAGCGGG + Intergenic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1017047157 6:150357439-150357461 ATGTAGACTCAGAAGTTAGATGG + Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1018050836 6:160006272-160006294 CTGGAGACGCGGAAGGCGCATGG - Intronic
1018474895 6:164130513-164130535 TTGGTGACTCCAAAGGTGGAAGG + Intergenic
1018696944 6:166397788-166397810 CTGTGGTCCCAGAAGGTGGAGGG - Intergenic
1018799677 6:167212307-167212329 CTTGGGACCCAGAAGGTGGCTGG + Intergenic
1018813288 6:167313186-167313208 TTGGGGACCCAGAAGGTGGCTGG - Intronic
1019001934 6:168761272-168761294 CTGTAGACTCAGGAGTTGCAAGG - Intergenic
1019033997 6:169039493-169039515 CTGGAGACTTGGAGGGTGGAAGG + Intergenic
1019098440 6:169607612-169607634 CTGGAGACTCAGAAGGGTAGAGG + Intronic
1019098861 6:169610880-169610902 TTGGAGACTCACAAGGGGGCAGG + Intronic
1019192591 6:170261851-170261873 ATGGAGAATCAGCAGGTGCACGG + Intergenic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019522962 7:1468838-1468860 CTGGAGGCTCAGCAGATGCAGGG - Intergenic
1019978215 7:4601483-4601505 CTGGAGACTCTGAAGGGTGGGGG + Intergenic
1020511693 7:9064727-9064749 CTGCATCCTCACAAGGTGGAAGG - Intergenic
1020637508 7:10714322-10714344 CTCGAAACTCAGAAGGTGGTGGG - Intergenic
1020966944 7:14882596-14882618 ATAGAGACTCAGAAGGGAGAAGG - Intronic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021437308 7:20634025-20634047 TTGGAGACTCAGAGGCTGAAAGG - Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1022354165 7:29596281-29596303 CTGAAGACTCAGAAGTGGGGAGG + Intergenic
1023772243 7:43568399-43568421 CTGGAGGCTCTTAAGGTGGCAGG - Intergenic
1024325982 7:48109556-48109578 CTAGAGCTTGAGAAGGTGGAAGG - Intergenic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1024979719 7:55147080-55147102 CTGGAGACTCAGAAGCATGTAGG - Intronic
1026070995 7:67119483-67119505 CCGAAGACTCAGAAGGGAGAAGG - Intronic
1026127615 7:67593418-67593440 CTGGTCACCCAGAAGGTAGAAGG + Intergenic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027267480 7:76502410-76502432 CAGGAGGCACAGCAGGTGGAAGG - Exonic
1027319295 7:77002275-77002297 CAGGAGGCACAGCAGGTGGAAGG - Intergenic
1027345497 7:77255406-77255428 TTGGATTATCAGAAGGTGGAAGG - Intronic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028870405 7:95765361-95765383 CTGGAAACTAAGAGGGAGGAGGG + Intergenic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1029928469 7:104344418-104344440 TTGGAGATTCAGAAGGGGAAGGG - Intronic
1030145755 7:106353161-106353183 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030715846 7:112805949-112805971 CTAAAGAGGCAGAAGGTGGAGGG - Intergenic
1030991544 7:116307143-116307165 ATGGAGACTTAGAAGGGTGATGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031656608 7:124363917-124363939 TTAGAGACTCATAAGGGGGAGGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032017534 7:128389428-128389450 CTGGAGCCACAGAAGCTGAAAGG + Intergenic
1033919862 7:146377370-146377392 CTAGACACTCAGCAGGTAGACGG - Intronic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034071701 7:148192259-148192281 GTGGAGACTCAGAAGGGTGTAGG - Intronic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035130414 7:156647352-156647374 TTGGAGACTCAGGAGGCGGAGGG - Intronic
1035130501 7:156648261-156648283 TTGGAGTCACACAAGGTGGAGGG + Intronic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035472201 7:159117644-159117666 CAGGTGACTCTGAAGATGGAAGG - Intronic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036553100 8:9832543-9832565 CTGTAGCCTCAGCAGGTGGGAGG - Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037586869 8:20283016-20283038 CTGGGGGCTCAGAAGTGGGATGG + Intronic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038779211 8:30556504-30556526 CAGGAGACACAGGAGGGGGAGGG - Intronic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1039098347 8:33911922-33911944 ATGAAGACTCAGAAGGGTGAGGG + Intergenic
1039201661 8:35101341-35101363 TTAGAGCCTCAGAAGGAGGACGG - Intergenic
1039781994 8:40794957-40794979 CTGGAAGCTCAGAAGAGGGAGGG + Intronic
1039836131 8:41257714-41257736 CTGGAGACTCAGAAGATCAGAGG - Intergenic
1039897772 8:41728404-41728426 CTGAAGACTCAGAGGGTGGGAGG + Intronic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040352964 8:46587029-46587051 CTGGTGAGACAGAAGGTGTAAGG - Intergenic
1040393889 8:46976123-46976145 ATGGAGACGCAGCGGGTGGAAGG + Intergenic
1040405186 8:47094743-47094765 TTGGAGACTCAGAAGAAGAAAGG + Intergenic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041319254 8:56596363-56596385 TAGGAGACTCAGAAGGTGGGAGG - Intergenic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1041937351 8:63348477-63348499 TTGGAGACTCAGAAGAGGCAAGG - Intergenic
1042040831 8:64586914-64586936 CTTTAGACACAGTAGGTGGAAGG + Intergenic
1042157121 8:65856420-65856442 GTGGAGACTCACAAAATGGATGG + Intergenic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042716359 8:71777340-71777362 TTGGAGACTTGGAAGGTGGGAGG + Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1043736315 8:83749771-83749793 TTGGAGACTCAGAAGGGTAAAGG - Intergenic
1044122115 8:88410841-88410863 GAGGAAACACAGAAGGTGGATGG + Intergenic
1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG + Intergenic
1044735301 8:95272502-95272524 CTGGAGACTCAGAAGAGAGGAGG - Intergenic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045509986 8:102806613-102806635 CTGTTGACTCAGAGGGTGGCCGG + Intergenic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046238964 8:111465187-111465209 TTAGAGACTCAGAATGTGGAGGG + Intergenic
1046777957 8:118183832-118183854 CTTGAGATTCAGAAGGCGGGAGG - Intergenic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047430798 8:124789818-124789840 CAGGAGATCCAGAAGGTGGCAGG - Intergenic
1047537346 8:125731957-125731979 CTGGAGACGGAGACGGGGGAGGG + Intergenic
1047560282 8:125979963-125979985 CTGGAGACTCAGAATTTGGGAGG + Intergenic
1047633817 8:126737490-126737512 TTAGAGACTCAGAAGGAGAAGGG - Intergenic
1048102006 8:131362531-131362553 TTGGAGACTCAGAGGGTGAGTGG + Intergenic
1048750529 8:137668616-137668638 CTGGGAACTGAGAAGGTTGAAGG + Intergenic
1049813663 8:144587970-144587992 CTCCAGTCTCTGAAGGTGGAAGG + Intronic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1051012558 9:12436252-12436274 CAAAAGACTCAGAAGGGGGAAGG - Intergenic
1051710787 9:19928355-19928377 CTAGAGTCTAAAAAGGTGGAAGG + Intergenic
1051882977 9:21859026-21859048 CTGGAACCTCACACGGTGGAAGG + Intronic
1052061726 9:23967732-23967754 CTGGAGACTCAGAGGATGGGAGG - Intergenic
1052158563 9:25226411-25226433 CTGGAGTCCCAAAGGGTGGAGGG + Intergenic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052599408 9:30605285-30605307 CTGGAGACTGAGAAGCAGGGAGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052975182 9:34405001-34405023 CTGGAGCCTGAGGAGGAGGATGG + Intronic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053750139 9:41245072-41245094 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054255638 9:62809411-62809433 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1054335673 9:63806196-63806218 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1054880347 9:70138061-70138083 GTGGAGACTTAGAAGGGTGAGGG - Intronic
1055185291 9:73444556-73444578 CTGGGGATTGAGAAGGTGTATGG + Intergenic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1055467650 9:76581769-76581791 CTGGGTACTCAGAGGGTGGCTGG - Intergenic
1055634986 9:78268215-78268237 CTGGTGAATAAGAAGGTGAAGGG + Intronic
1055672070 9:78617824-78617846 TGGGAGATTCAGAGGGTGGAAGG + Intergenic
1056720248 9:89065071-89065093 CTGAAGACTTAGAAGCTGAAAGG + Intronic
1056728547 9:89143542-89143564 CAGGAGTTTCAGAAGGTGAAGGG + Intronic
1057218754 9:93244388-93244410 CAGGAGAGTATGAAGGTGGAGGG - Intronic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058348043 9:103988003-103988025 TTGGAGACTCAGAAGTAGGTAGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1059491691 9:114673061-114673083 CTGGACTCTCAGAAGGACGAAGG + Intergenic
1059636923 9:116180130-116180152 TTGGAGTCACAGAATGTGGATGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059828225 9:118058118-118058140 ATGGAGACTCAGAAGCCTGAGGG - Intergenic
1060333448 9:122698167-122698189 TTGGAGACTCCGAAGTGGGAAGG + Intergenic
1061421691 9:130476221-130476243 CTGGGGCCTCCGAAGGTGGGAGG + Intronic
1061938529 9:133871878-133871900 CTGGGGGCTCAGAAGGGGCAGGG - Intronic
1203371924 Un_KI270442v1:315169-315191 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1185859566 X:3564982-3565004 TTGGAGACTCCGAAGTGGGAGGG + Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186122544 X:6379589-6379611 CTGGAGACTCAGAAGTTGGGAGG - Intergenic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187435537 X:19265404-19265426 TCAGAGACTCAGAAGGTGGAGGG - Intergenic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188188771 X:27148250-27148272 TTGGAGACTCAAAAAGTGGGAGG + Intergenic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1189633775 X:42983056-42983078 CTGCATACTCACATGGTGGAAGG + Intergenic
1190056340 X:47183215-47183237 ATGGAGACTCAAAAGGTGGAGGG + Intronic
1190463079 X:50698343-50698365 CTGGTGACTGAGAAGGGGCATGG - Intronic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1191734532 X:64375244-64375266 CAGGAGACTGAGGAGGTGGGAGG + Intronic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1191885635 X:65885031-65885053 CTGCATCCTCAGATGGTGGAAGG - Intergenic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192215943 X:69158235-69158257 CTGGAGAATCAGAAACTGGCAGG + Intergenic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192884445 X:75321994-75322016 TTGGAGACTGAGAAGGGGTAGGG - Intergenic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1193120254 X:77815910-77815932 CTTGAGAGTCTGAAGGTGGGAGG - Intergenic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193222977 X:78948620-78948642 CTAGAGACTCAGAAGAGGGTGGG - Intronic
1193460316 X:81783798-81783820 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193592281 X:83404569-83404591 CTGCAGACTGAGAAGTTGAAGGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193630026 X:83873718-83873740 CTGGAGACTCAAAGGATGAAAGG + Exonic
1193750758 X:85340264-85340286 CTAGGGGCACAGAAGGTGGATGG + Intronic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194089909 X:89572931-89572953 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1194145648 X:90258690-90258712 TTGGAGATTCAGGAGGGGGAAGG + Intergenic
1194228439 X:91291606-91291628 TTGGAGACTCAGAAGTGGGTAGG - Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195520385 X:105822566-105822588 CTGGAGACGAAGAAGCTAGAAGG - Exonic
1196465623 X:115969091-115969113 CAGGAGACACAGAAGATGGAGGG - Intergenic
1196486001 X:116207832-116207854 CTGGATAATCAGAAGTTGGGAGG + Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197440112 X:126477130-126477152 CTGGAGAAAGAGAAGGTGAAGGG + Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1197712639 X:129682824-129682846 CTGTATCCTCACAAGGTGGAAGG + Intergenic
1197987602 X:132283612-132283634 TTGGCGTCTCAGAAGGGGGAAGG - Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198134421 X:133733273-133733295 TTAGGGACTCAGAAGGGGGAGGG + Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198539291 X:137619678-137619700 CTAGAGACATAGAAAGTGGATGG - Intergenic
1198661753 X:138976533-138976555 ATAAAGACTCAGAAGGGGGATGG + Intronic
1198676451 X:139136354-139136376 TTAGAGACTCAGAACGGGGAGGG - Intronic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199110821 X:143931843-143931865 TTGGAGATTCAGAAGGGGAAGGG - Intergenic
1199242274 X:145561180-145561202 TTGGAGACTTAGAAGGGGAAGGG + Intergenic
1200062064 X:153488166-153488188 CTGGAGGCTCACAAGTTAGAGGG - Intronic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200442560 Y:3228985-3229007 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200794309 Y:7326496-7326518 CTGGAGACTCAGAAGTGGGGAGG + Intergenic
1200987288 Y:9316178-9316200 CTGAGGACTCAGAAGTTGGATGG + Intergenic
1201066423 Y:10099957-10099979 ATGGAGACTCAGGAGGGTGAGGG - Intergenic
1201145241 Y:11061156-11061178 CAGGAGACTCAGAAGTGTGATGG + Intergenic
1201474833 Y:14369228-14369250 CTGGAGACTCAGAATCTGGGAGG + Intergenic
1201695339 Y:16818278-16818300 ATGGGGACTTAGAAGGCGGATGG + Intergenic
1201761461 Y:17543930-17543952 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1201840091 Y:18362060-18362082 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1202118296 Y:21496470-21496492 CTGAGGTCTCAGAAGCTGGACGG - Intergenic
1202120748 Y:21520010-21520032 CTGAGGTCTCAGAAGCTGGATGG - Intronic
1202123199 Y:21543551-21543573 CTGAGGTCTCAGAAGCTGGATGG - Intronic
1202155807 Y:21885830-21885852 CTGAGGTCTCAGAAGCTGGACGG + Intronic
1202158255 Y:21909371-21909393 CTGAGGTCTCAGAAGCTGGATGG + Intronic
1202184708 Y:22174296-22174318 CTGAGGTCTCAGAAGCTGGATGG + Intronic
1202198139 Y:22317435-22317457 CTGAGGTCTCAGAAGCTGGATGG - Intronic
1202206652 Y:22412105-22412127 CTGAGGTCTCAGAAGCTGGATGG - Intronic