ID: 1138304679

View in Genome Browser
Species Human (GRCh38)
Location 16:55963600-55963622
Sequence GGTCTTCTTCCCACTGCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138304679_1138304684 3 Left 1138304679 16:55963600-55963622 CCCCATGCAGTGGGAAGAAGACC No data
Right 1138304684 16:55963626-55963648 TCCCCTGCCAGTGTCAGCCTTGG No data
1138304679_1138304690 14 Left 1138304679 16:55963600-55963622 CCCCATGCAGTGGGAAGAAGACC No data
Right 1138304690 16:55963637-55963659 TGTCAGCCTTGGTCCATTAAGGG No data
1138304679_1138304689 13 Left 1138304679 16:55963600-55963622 CCCCATGCAGTGGGAAGAAGACC No data
Right 1138304689 16:55963636-55963658 GTGTCAGCCTTGGTCCATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138304679 Original CRISPR GGTCTTCTTCCCACTGCATG GGG (reversed) Intergenic
No off target data available for this crispr