ID: 1138305220

View in Genome Browser
Species Human (GRCh38)
Location 16:55968501-55968523
Sequence GCAGCATTTATGGACAGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138305220_1138305223 -3 Left 1138305220 16:55968501-55968523 CCTATTCTGTCCATAAATGCTGC No data
Right 1138305223 16:55968521-55968543 TGCCTGACCCCATTGCAGGCTGG No data
1138305220_1138305228 18 Left 1138305220 16:55968501-55968523 CCTATTCTGTCCATAAATGCTGC No data
Right 1138305228 16:55968542-55968564 GGAATTCTCTGAATCTGTTCTGG No data
1138305220_1138305230 27 Left 1138305220 16:55968501-55968523 CCTATTCTGTCCATAAATGCTGC No data
Right 1138305230 16:55968551-55968573 TGAATCTGTTCTGGTTTTGAGGG No data
1138305220_1138305229 26 Left 1138305220 16:55968501-55968523 CCTATTCTGTCCATAAATGCTGC No data
Right 1138305229 16:55968550-55968572 CTGAATCTGTTCTGGTTTTGAGG No data
1138305220_1138305222 -7 Left 1138305220 16:55968501-55968523 CCTATTCTGTCCATAAATGCTGC No data
Right 1138305222 16:55968517-55968539 ATGCTGCCTGACCCCATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138305220 Original CRISPR GCAGCATTTATGGACAGAAT AGG (reversed) Intergenic