ID: 1138305221

View in Genome Browser
Species Human (GRCh38)
Location 16:55968511-55968533
Sequence ATGGGGTCAGGCAGCATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138305221_1138305229 16 Left 1138305221 16:55968511-55968533 CCATAAATGCTGCCTGACCCCAT No data
Right 1138305229 16:55968550-55968572 CTGAATCTGTTCTGGTTTTGAGG No data
1138305221_1138305230 17 Left 1138305221 16:55968511-55968533 CCATAAATGCTGCCTGACCCCAT No data
Right 1138305230 16:55968551-55968573 TGAATCTGTTCTGGTTTTGAGGG No data
1138305221_1138305228 8 Left 1138305221 16:55968511-55968533 CCATAAATGCTGCCTGACCCCAT No data
Right 1138305228 16:55968542-55968564 GGAATTCTCTGAATCTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138305221 Original CRISPR ATGGGGTCAGGCAGCATTTA TGG (reversed) Intergenic