ID: 1138305225

View in Genome Browser
Species Human (GRCh38)
Location 16:55968528-55968550
Sequence GAGAATTCCAGCCTGCAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138305225_1138305229 -1 Left 1138305225 16:55968528-55968550 CCCCATTGCAGGCTGGAATTCTC No data
Right 1138305229 16:55968550-55968572 CTGAATCTGTTCTGGTTTTGAGG No data
1138305225_1138305228 -9 Left 1138305225 16:55968528-55968550 CCCCATTGCAGGCTGGAATTCTC No data
Right 1138305228 16:55968542-55968564 GGAATTCTCTGAATCTGTTCTGG No data
1138305225_1138305230 0 Left 1138305225 16:55968528-55968550 CCCCATTGCAGGCTGGAATTCTC No data
Right 1138305230 16:55968551-55968573 TGAATCTGTTCTGGTTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138305225 Original CRISPR GAGAATTCCAGCCTGCAATG GGG (reversed) Intergenic