ID: 1138305230

View in Genome Browser
Species Human (GRCh38)
Location 16:55968551-55968573
Sequence TGAATCTGTTCTGGTTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138305226_1138305230 -1 Left 1138305226 16:55968529-55968551 CCCATTGCAGGCTGGAATTCTCT No data
Right 1138305230 16:55968551-55968573 TGAATCTGTTCTGGTTTTGAGGG No data
1138305220_1138305230 27 Left 1138305220 16:55968501-55968523 CCTATTCTGTCCATAAATGCTGC No data
Right 1138305230 16:55968551-55968573 TGAATCTGTTCTGGTTTTGAGGG No data
1138305221_1138305230 17 Left 1138305221 16:55968511-55968533 CCATAAATGCTGCCTGACCCCAT No data
Right 1138305230 16:55968551-55968573 TGAATCTGTTCTGGTTTTGAGGG No data
1138305224_1138305230 5 Left 1138305224 16:55968523-55968545 CCTGACCCCATTGCAGGCTGGAA No data
Right 1138305230 16:55968551-55968573 TGAATCTGTTCTGGTTTTGAGGG No data
1138305225_1138305230 0 Left 1138305225 16:55968528-55968550 CCCCATTGCAGGCTGGAATTCTC No data
Right 1138305230 16:55968551-55968573 TGAATCTGTTCTGGTTTTGAGGG No data
1138305227_1138305230 -2 Left 1138305227 16:55968530-55968552 CCATTGCAGGCTGGAATTCTCTG No data
Right 1138305230 16:55968551-55968573 TGAATCTGTTCTGGTTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138305230 Original CRISPR TGAATCTGTTCTGGTTTTGA GGG Intergenic