ID: 1138307043

View in Genome Browser
Species Human (GRCh38)
Location 16:55987918-55987940
Sequence GAAATAGATTAATCTACTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138307040_1138307043 5 Left 1138307040 16:55987890-55987912 CCAGTGGGTCATGAGGGCTCTGC No data
Right 1138307043 16:55987918-55987940 GAAATAGATTAATCTACTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138307043 Original CRISPR GAAATAGATTAATCTACTCA TGG Intergenic
No off target data available for this crispr