ID: 1138311668

View in Genome Browser
Species Human (GRCh38)
Location 16:56029055-56029077
Sequence ATACCTGGTGTCTCTCATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138311668_1138311675 18 Left 1138311668 16:56029055-56029077 CCTCAATGAGAGACACCAGGTAT No data
Right 1138311675 16:56029096-56029118 AGGGATTCTACCAAAACAAGTGG No data
1138311668_1138311671 -2 Left 1138311668 16:56029055-56029077 CCTCAATGAGAGACACCAGGTAT No data
Right 1138311671 16:56029076-56029098 ATCCAAGGAACACCAGCAAAAGG No data
1138311668_1138311672 -1 Left 1138311668 16:56029055-56029077 CCTCAATGAGAGACACCAGGTAT No data
Right 1138311672 16:56029077-56029099 TCCAAGGAACACCAGCAAAAGGG No data
1138311668_1138311677 29 Left 1138311668 16:56029055-56029077 CCTCAATGAGAGACACCAGGTAT No data
Right 1138311677 16:56029107-56029129 CAAAACAAGTGGCCCAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138311668 Original CRISPR ATACCTGGTGTCTCTCATTG AGG (reversed) Intergenic
No off target data available for this crispr