ID: 1138312998

View in Genome Browser
Species Human (GRCh38)
Location 16:56044019-56044041
Sequence CTCTTCCCATTTAACATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138312998_1138313004 17 Left 1138312998 16:56044019-56044041 CCATGCATGTTAAATGGGAAGAG No data
Right 1138313004 16:56044059-56044081 CTCATCTGAGCCCCCTATAGAGG No data
1138312998_1138313002 -9 Left 1138312998 16:56044019-56044041 CCATGCATGTTAAATGGGAAGAG No data
Right 1138313002 16:56044033-56044055 TGGGAAGAGCCTGGGGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138312998 Original CRISPR CTCTTCCCATTTAACATGCA TGG (reversed) Intergenic
No off target data available for this crispr