ID: 1138315182

View in Genome Browser
Species Human (GRCh38)
Location 16:56063832-56063854
Sequence CACAAACTCCCTGTTCGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138315182_1138315189 22 Left 1138315182 16:56063832-56063854 CCTGGACGAACAGGGAGTTTGTG No data
Right 1138315189 16:56063877-56063899 GCACTTGATGCTTGAATCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138315182 Original CRISPR CACAAACTCCCTGTTCGTCC AGG (reversed) Intergenic
No off target data available for this crispr