ID: 1138317484

View in Genome Browser
Species Human (GRCh38)
Location 16:56082647-56082669
Sequence TTGTCTATGAACCAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138317484_1138317491 17 Left 1138317484 16:56082647-56082669 CCCTCTTCCTGGTTCATAGACAA No data
Right 1138317491 16:56082687-56082709 CTTACATGGTGGAAGGAAAAAGG No data
1138317484_1138317488 6 Left 1138317484 16:56082647-56082669 CCCTCTTCCTGGTTCATAGACAA No data
Right 1138317488 16:56082676-56082698 CTCACTGCATCCTTACATGGTGG No data
1138317484_1138317487 3 Left 1138317484 16:56082647-56082669 CCCTCTTCCTGGTTCATAGACAA No data
Right 1138317487 16:56082673-56082695 CTTCTCACTGCATCCTTACATGG No data
1138317484_1138317492 18 Left 1138317484 16:56082647-56082669 CCCTCTTCCTGGTTCATAGACAA No data
Right 1138317492 16:56082688-56082710 TTACATGGTGGAAGGAAAAAGGG No data
1138317484_1138317489 10 Left 1138317484 16:56082647-56082669 CCCTCTTCCTGGTTCATAGACAA No data
Right 1138317489 16:56082680-56082702 CTGCATCCTTACATGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138317484 Original CRISPR TTGTCTATGAACCAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr