ID: 1138318600

View in Genome Browser
Species Human (GRCh38)
Location 16:56091478-56091500
Sequence GAGGTGAAACAGGGTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138318591_1138318600 6 Left 1138318591 16:56091449-56091471 CCAGACATTCAGATCATTCAGAC No data
Right 1138318600 16:56091478-56091500 GAGGTGAAACAGGGTGAGGAGGG No data
1138318590_1138318600 7 Left 1138318590 16:56091448-56091470 CCCAGACATTCAGATCATTCAGA No data
Right 1138318600 16:56091478-56091500 GAGGTGAAACAGGGTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138318600 Original CRISPR GAGGTGAAACAGGGTGAGGA GGG Intergenic
No off target data available for this crispr