ID: 1138319629

View in Genome Browser
Species Human (GRCh38)
Location 16:56101071-56101093
Sequence AAAAGTTTTGTGAAGTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138319629_1138319632 30 Left 1138319629 16:56101071-56101093 CCTCCAGACTTCACAAAACTTTT 0: 1
1: 0
2: 1
3: 25
4: 221
Right 1138319632 16:56101124-56101146 AAGTTCCAGGATACATGTGCAGG 0: 204
1: 608
2: 1195
3: 2539
4: 3718
1138319629_1138319631 17 Left 1138319629 16:56101071-56101093 CCTCCAGACTTCACAAAACTTTT 0: 1
1: 0
2: 1
3: 25
4: 221
Right 1138319631 16:56101111-56101133 CAACTTTTATTTTAAGTTCCAGG 0: 100
1: 451
2: 1588
3: 3601
4: 5566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138319629 Original CRISPR AAAAGTTTTGTGAAGTCTGG AGG (reversed) Intergenic
900281910 1:1875342-1875364 AAAAGTTTAGTGGGGTGTGGTGG - Intronic
903200743 1:21736112-21736134 AAAAATTTTGTCAGGTGTGGTGG + Intronic
906927753 1:50137356-50137378 TAAAGCTTTGTGAAGAGTGGAGG + Intronic
908428570 1:64033023-64033045 AAAAGTTTTGGGATGGATGGTGG + Intronic
910656146 1:89620863-89620885 AAAACTTTTGTGAAGATTGGTGG - Intergenic
915475103 1:156148574-156148596 AAAAATACTATGAAGTCTGGCGG + Intronic
915805154 1:158840603-158840625 AAAAGATTTGTGCGGTTTGGGGG - Intronic
916643601 1:166759163-166759185 AAAAGTTTTGTGAATGCTTTAGG + Intergenic
916678914 1:167087026-167087048 AAATCTTTCATGAAGTCTGGTGG + Intronic
918275368 1:182949136-182949158 AAAAGTTTTATGGAGTATAGGGG + Intronic
918530866 1:185520980-185521002 AAGAGTGTTTTGAAGTCTGTTGG - Intergenic
919301744 1:195778828-195778850 TAAAGTTTTTTTTAGTCTGGAGG + Intergenic
923573415 1:235136940-235136962 AAAAGTGTTGTAAAGGCTGAGGG - Intronic
924168841 1:241315587-241315609 ACAATTTTTGTGAAGTCTCTGGG + Intronic
924712458 1:246541101-246541123 AAAAGTGTTTTGAAGTCTTGAGG + Exonic
1062890300 10:1054916-1054938 AAACGTCATGTGAAGACTGGCGG + Intronic
1065104198 10:22364477-22364499 ATAAGATTTGCAAAGTCTGGGGG + Intronic
1065648790 10:27865388-27865410 AAAAGGTTTGTGCAGACTTGTGG - Intronic
1069182098 10:65374395-65374417 AAAAGATTAGTCAAGTGTGGTGG - Intergenic
1069291483 10:66785891-66785913 ACAATTTTTGTGATATCTGGGGG - Intronic
1071235137 10:83636774-83636796 ATAAGTTCAGTGAAGTCTGAGGG + Intergenic
1072412292 10:95214464-95214486 ACTAATTTTCTGAAGTCTGGAGG - Intronic
1072561477 10:96579898-96579920 AGAAGTTGTGTGAAGTCTTTTGG - Intronic
1074354674 10:112771481-112771503 AAGAGCTTTGTGTAGTTTGGTGG + Intronic
1074661932 10:115669163-115669185 AAATGTTTTCTTAAGTCTTGGGG - Intronic
1075953343 10:126501182-126501204 AAAGGTTTTGTGGAATCTGAAGG + Intronic
1076030221 10:127151109-127151131 AAGAGTTTTCTGAGGTCTGCAGG - Intronic
1077064594 11:635249-635271 AGAAGTTTAGTGGAGGCTGGGGG + Intergenic
1077799780 11:5526116-5526138 AAAAGATTTGAGAAGTTTTGTGG + Intronic
1080870128 11:36229546-36229568 AAAACATCTCTGAAGTCTGGGGG - Exonic
1080888434 11:36387774-36387796 AAAAGGTCTGAGAAGGCTGGAGG + Intronic
1081414189 11:42793741-42793763 AAAACTTTTGTGATGTCTAAAGG - Intergenic
1083150517 11:60789094-60789116 AAGAGTTTTGGGAAGTTTGGAGG - Intronic
1083529569 11:63407356-63407378 AAGAGTTAGGTGAAGACTGGTGG - Intronic
1084922028 11:72478845-72478867 GAAAGTTTTGTAAAATTTGGAGG - Intergenic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1089712999 11:120330345-120330367 AAGTGGTTTGTGAAGGCTGGGGG + Exonic
1090332136 11:125940510-125940532 AAAAGTTGTGTGAGGTATGCCGG - Intergenic
1093202465 12:16205925-16205947 AAAAATTTAGTGAAGTCTGAGGG - Intronic
1094455568 12:30628946-30628968 AAATGTTTTCTGAAATGTGGAGG - Intergenic
1096155700 12:49340289-49340311 TAAAATTTTATGAAGTCTAGTGG + Intergenic
1096489421 12:52005813-52005835 AACAGATTTGGGAAGACTGGGGG + Intergenic
1097034141 12:56111431-56111453 AAAAATTTTGAGAAATGTGGAGG - Intronic
1097804446 12:63950221-63950243 AAAAGGTATGTGGAGGCTGGGGG - Intronic
1099618711 12:84974108-84974130 AAAAGTTTTGAGTAGTATGCAGG - Intergenic
1099861769 12:88231352-88231374 AAAGGTTTGGTGAGGTCTGGGGG - Intergenic
1099861790 12:88231461-88231483 AAAGGTTTGGTGAGGTCTGGGGG - Intergenic
1102206553 12:111094870-111094892 GGAAGTTTTGTGCAGCCTGGAGG + Intronic
1104404751 12:128508225-128508247 AAAAGTCTTATGAAATCTGATGG - Intronic
1106862196 13:33921769-33921791 AAAATGTGTTTGAAGTCTGGAGG - Intronic
1107109476 13:36680594-36680616 AAAAGTTAAGTGAAGTTTGAAGG - Intronic
1107131112 13:36896493-36896515 AAGAGATTTGGGAGGTCTGGAGG - Intronic
1107308706 13:39052658-39052680 AAAAGTTTTGGAAAGTTTGTTGG + Intergenic
1108284039 13:48887921-48887943 AAATTTTTTTTGAAGTTTGGTGG + Intergenic
1109156486 13:58916906-58916928 AAAATTTTTGTGAAATCTCAGGG + Intergenic
1110896283 13:80756420-80756442 AAAAATTTTGGGTAGTCTGCAGG - Intergenic
1111550475 13:89803865-89803887 CAAAGTTTTTTCAAGTATGGAGG - Intergenic
1112092533 13:96096581-96096603 AAACTTTTTGTAAAGTCTGATGG + Intronic
1113114218 13:106857785-106857807 AAAAATTTAGTGCAGGCTGGTGG + Intergenic
1113205909 13:107915721-107915743 AACAGTTTTGTGAGGTCTGCAGG - Intergenic
1114161111 14:20168763-20168785 AAGAGTTTTGGGAAGAGTGGTGG + Intergenic
1115088990 14:29551344-29551366 AATAGTGTAGTGAAGTGTGGGGG - Intergenic
1115150865 14:30283811-30283833 AAAACTCTTGTCAAATCTGGAGG - Intergenic
1117730030 14:58713082-58713104 AAGACTTTTGTGATGTCTGATGG - Intergenic
1121204978 14:92156771-92156793 AAGAGACTTGTGAAGTATGGTGG + Intronic
1122598844 14:102910963-102910985 AGAAGGTCTGTGAAGTGTGGAGG + Exonic
1126485068 15:49170881-49170903 AATAGTTTAGTGATGTCTCGGGG + Intronic
1128058569 15:64718728-64718750 AAAAGGTCTGGGAAGTATGGGGG + Intergenic
1128771861 15:70288972-70288994 AAAGGGGTTCTGAAGTCTGGAGG - Intergenic
1130684128 15:86022222-86022244 AAAAGTTGTGGGAACTGTGGAGG - Intergenic
1131696985 15:94888414-94888436 AAATGTTTTGTGAAACATGGCGG + Intergenic
1133697363 16:8277675-8277697 AAACCTTATGAGAAGTCTGGAGG - Intergenic
1136006209 16:27331051-27331073 CAAATTTTTGAGAAGTCTGGGGG - Intronic
1138319629 16:56101071-56101093 AAAAGTTTTGTGAAGTCTGGAGG - Intergenic
1138729880 16:59182983-59183005 AAAAGTGTGGTGAACTTTGGGGG + Intergenic
1141109853 16:81263261-81263283 AAAAAATTAGTGAAGTGTGGTGG - Intronic
1143583038 17:7837270-7837292 AAGAGTTGTGTGTAGTATGGGGG + Intergenic
1147272387 17:39284191-39284213 AAAAGCTTTGTGAAGTAGAGTGG - Intronic
1149099854 17:52891626-52891648 AAAAATTTTTGGAACTCTGGAGG + Intronic
1149857052 17:60091881-60091903 GATAGTTCTGTGAAGACTGGGGG - Intergenic
1149976893 17:61275001-61275023 AAAAAATTAGTGAAGTATGGTGG - Intronic
1150707513 17:67500836-67500858 AAAAATTTTGTCAAGTGTGGTGG - Intronic
1153699295 18:7676523-7676545 AAAATTTTGGTGAGGTTTGGGGG - Intronic
1154354625 18:13615553-13615575 AGAAGTGGTGTGAAGTCTGTCGG - Intronic
1155559819 18:27063597-27063619 AAATGTTCTCTGAAGTCTTGTGG + Intronic
1157268589 18:46250817-46250839 AAAAGTTTGGTGAGATTTGGGGG - Intronic
1157323240 18:46649985-46650007 AGAAGTTTTGGAAAGGCTGGAGG + Intronic
1158189023 18:54804367-54804389 ATAAGTTTTGTGAGATCTGATGG + Intronic
1158970007 18:62657415-62657437 AAAAGTCTGGTGATATCTGGGGG + Intergenic
1159529037 18:69631823-69631845 AACAGGTTTGTGAAATCTAGAGG - Intronic
1160009342 18:75092279-75092301 AAAAGTTCTGTGAACTCCTGAGG + Intergenic
1161254554 19:3300279-3300301 AAAAATTTTGTGGAGGATGGTGG - Intergenic
1163893839 19:20040107-20040129 AAAAATTTAGCCAAGTCTGGTGG + Intergenic
925689453 2:6506219-6506241 CAAAGACATGTGAAGTCTGGAGG - Intergenic
927876406 2:26658267-26658289 AAAAGTTTCCTGAAATCTGAGGG + Intergenic
928927750 2:36596614-36596636 AAAAAATTAGTGAAGTCCGGTGG - Intronic
930219762 2:48734639-48734661 AATAGTTTTGTGAACTATTGTGG + Intronic
930808280 2:55514604-55514626 AAGACTATTGTGAATTCTGGAGG - Intergenic
931591403 2:63887459-63887481 AAAAGTTTTGAGAATTCTCTAGG + Exonic
931872903 2:66480840-66480862 GAAACTTTTGTGAAGAATGGTGG + Intronic
932225416 2:70035853-70035875 AAAAATTTTGTGAAGTCATTAGG - Intergenic
933115876 2:78470516-78470538 AACAATTTCATGAAGTCTGGGGG - Intergenic
933143322 2:78820803-78820825 ATAAGTGGTGTTAAGTCTGGAGG + Intergenic
935467824 2:103420272-103420294 TGAAGTTTTCTGAAGTCTAGGGG + Intergenic
935614882 2:105067978-105068000 AAAATTTTTAAGAAGTGTGGTGG - Intronic
936969335 2:118161890-118161912 AAAATTTTTATGAAGTCTTTAGG - Intergenic
937538146 2:122916354-122916376 CATAGTTTGGTGAAGCCTGGGGG + Intergenic
938205757 2:129421550-129421572 AAAAGATGTGTAAAGTTTGGGGG - Intergenic
940574999 2:155491870-155491892 AAAAATTATGTTAAGTGTGGTGG - Intergenic
941133769 2:161687164-161687186 AAAAGTCTTCTTAAGGCTGGGGG - Intronic
942226986 2:173825722-173825744 AATAGTCTTGAGAAGTCTGCTGG + Intergenic
942786999 2:179711291-179711313 GAAAGTTTTGTCAAGTGTTGGGG - Intronic
943837477 2:192531738-192531760 AAAAGATTAGTCAAGTGTGGTGG + Intergenic
945187923 2:207158318-207158340 AAAAGTCTTTTGAGGTCTGATGG - Intronic
945594566 2:211775781-211775803 AAAACCTTTGTGAAATCTGAGGG - Intronic
948355931 2:237377044-237377066 TACATTTTTGTGAAGTCTGCTGG - Exonic
1169005037 20:2199730-2199752 AAAAGTTTTGTGGGGGGTGGGGG + Intergenic
1171416075 20:24981409-24981431 AAAACCTTTGTGCAGTCTGTGGG - Intronic
1175771200 20:61625695-61625717 ATTAATTTTGTGAAGTGTGGAGG - Intronic
1177235650 21:18386336-18386358 AAAAGTGTTGTTGAGTGTGGGGG - Intronic
1177621279 21:23597961-23597983 AATAGTTTCTTGAAGTCTGTGGG - Intergenic
1178451339 21:32704447-32704469 AAAGGTTTTGAGTAGACTGGAGG + Intronic
952412351 3:33060988-33061010 AAAAGGTGGGTGAAGGCTGGGGG + Intronic
952698565 3:36299511-36299533 AAAGGTTTTGAGGAGTCTTGGGG + Intergenic
953350408 3:42211030-42211052 AAAGCTTTTGTGGAGTCAGGGGG + Intronic
953795014 3:45978356-45978378 ATGAGTCTTGTGAGGTCTGGTGG - Intronic
955240686 3:57175407-57175429 AAAAATAGTGGGAAGTCTGGTGG - Intergenic
956074780 3:65493416-65493438 AAATGTTTTGTGGAATCTGGAGG - Intronic
956095313 3:65710104-65710126 AAAAGGCTTGTGAAATCTTGGGG - Intronic
956912462 3:73832844-73832866 AAAAGTTTTGATAAGTATGAGGG + Intergenic
957109459 3:75933988-75934010 AAATGTGTTGTGGAGTCTGGAGG - Intronic
957175225 3:76799474-76799496 AATATTTTTGTGAAGTCTTTAGG - Intronic
957352602 3:79045825-79045847 AAAAGCTTTCTCTAGTCTGGAGG + Intronic
958036865 3:88181084-88181106 AAAAGTTTTGTTAAGTCAAGTGG + Intergenic
958077801 3:88706429-88706451 AAAAGTTTTGTGAAGACTAAAGG + Intergenic
960495752 3:118372587-118372609 AAAAGTTAGGTGAAGACTGCAGG - Intergenic
961537012 3:127576502-127576524 CAAAGTTTTGAGAACTCTGAAGG + Intronic
961644849 3:128387457-128387479 GAAAGATCTGGGAAGTCTGGGGG + Intronic
962312294 3:134335180-134335202 AAGTCTTTTGTGAAGGCTGGAGG + Intergenic
963865117 3:150352085-150352107 AAAAATAATGTGAAGACTGGGGG + Intergenic
964552962 3:157905188-157905210 AAAAGTTTTGTGGATTTTGAGGG + Intergenic
964664588 3:159158387-159158409 AGAAGTTTTGTGAGTTCAGGTGG + Intronic
965159322 3:165111075-165111097 AAAAGTTTTGCCAAGTCTGTTGG - Intergenic
966486350 3:180475359-180475381 AAATGCTTTTTGAAGCCTGGAGG - Intergenic
966631031 3:182075269-182075291 CAAAGTTTTTTGAGGTCTGCTGG + Intergenic
966856750 3:184199386-184199408 AAAATTTTTGTAAAGTCTTATGG + Intronic
967520468 3:190426091-190426113 AAAAGGTTTGTGAAGGAAGGTGG - Intergenic
971656443 4:29352367-29352389 AAGCGTTTTGTGAAGTCTGTGGG - Intergenic
973265305 4:48204459-48204481 AAAAGGCACGTGAAGTCTGGAGG - Intronic
973897013 4:55423426-55423448 AAAAATTTTTTAAAGTCTAGTGG - Intronic
974067424 4:57092111-57092133 AAAAACTTTGTGAAATTTGGAGG - Intronic
974743434 4:66038160-66038182 TGAGGTTTTGTGAAGACTGGGGG - Intergenic
974835947 4:67251314-67251336 AAAATATTTGGGAAGACTGGAGG + Intergenic
974983015 4:68984895-68984917 ACAAGTCTTGTGAAATATGGAGG + Intergenic
976810381 4:89094094-89094116 AAAAGCTTTTTGATGTCTGCTGG - Intronic
977955937 4:103025754-103025776 TAAAGTTTTTTGACATCTGGAGG + Exonic
979355112 4:119694345-119694367 AAAAGTATTATGAAATCTTGTGG - Intergenic
980265621 4:130511801-130511823 AAAAAGTTTATGAATTCTGGAGG - Intergenic
981690082 4:147498630-147498652 AAAAAGTTTGTCAAGCCTGGTGG + Intronic
981836243 4:149057614-149057636 CAAAGCTCTGTGAAGTCAGGTGG - Intergenic
983391736 4:167140736-167140758 AAAGTTTTTCTGAACTCTGGGGG - Intronic
983851393 4:172585118-172585140 AACAGTCTAATGAAGTCTGGTGG + Intronic
983881677 4:172940169-172940191 AAAAGTTTTGCGAGGTTTTGTGG - Intronic
984499587 4:180542381-180542403 AACAGTTTTGTTAAGTTTGGGGG + Intergenic
985321036 4:188711306-188711328 ACAAGTTTTGGGTGGTCTGGTGG - Intergenic
985729987 5:1541964-1541986 AAAAGATTTTTGAAATCTAGAGG + Intergenic
987069423 5:14321828-14321850 ATAAGTCTTGTGAAATCTGATGG + Intronic
987262786 5:16220390-16220412 AAATGTTTTGGGATGTTTGGGGG + Intergenic
988055971 5:26097241-26097263 AAAAGTTTGCTGGAGTCTGGTGG - Intergenic
988176926 5:27740212-27740234 AAAATTTTTGTTAATTCTGGAGG + Intergenic
989095929 5:37781201-37781223 AAGGGTTTTGTGAGGTCAGGTGG + Intergenic
989404094 5:41041165-41041187 AAAAGTTCAGTAAAGTCTAGTGG + Intronic
993360382 5:86967645-86967667 AAGAGTTCTGTGAAGTTTAGTGG - Intergenic
994188554 5:96841949-96841971 ATAAGCTTTGGGAACTCTGGAGG - Intronic
995713410 5:115057547-115057569 TTAAGTTTTGTCAAGTCTTGAGG - Intergenic
996155732 5:120097114-120097136 AAATGGTTTGTGAATTCTGATGG + Intergenic
996290566 5:121847067-121847089 AAAATATTAGTGAAGTATGGTGG + Intergenic
998474206 5:142407128-142407150 AAAGGTTCAGTGGAGTCTGGGGG - Intergenic
998711735 5:144833612-144833634 AAAAGTTTCTTGAGTTCTGGTGG + Intergenic
999392985 5:151207764-151207786 AAAAGTTGGTTGAAGTCTGGCGG + Intronic
999404303 5:151293444-151293466 AAAAGTCTTCTGCAGTCTAGGGG + Exonic
1000497128 5:161998468-161998490 AAAAGAGAAGTGAAGTCTGGAGG - Intergenic
1000746238 5:165037451-165037473 CAACGTTCTGTGTAGTCTGGGGG + Intergenic
1000918234 5:167107687-167107709 AAAAGTTTGGAGACATCTGGAGG + Intergenic
1001620227 5:173077685-173077707 AAAAGTGTTCTGGAGGCTGGGGG - Intronic
1003322649 6:5065863-5065885 AAAAGTTTTTTGAAGTCTTGAGG + Intergenic
1003854597 6:10260427-10260449 AACAGTTTTGTGAGGTATGTAGG - Intergenic
1004427288 6:15514906-15514928 ATACATTTTGAGAAGTCTGGGGG - Intronic
1004716107 6:18217799-18217821 TACAGTTTTGTGAAGACAGGTGG + Exonic
1005359547 6:25017859-25017881 AAAAGTTCTGTAAAGTCTTCAGG + Intronic
1010117819 6:72336047-72336069 TTAAGTATTTTGAAGTCTGGTGG - Intronic
1010871067 6:81040433-81040455 TAAGGTTTTGTGGAGTCTTGAGG + Intergenic
1011263052 6:85488461-85488483 AAATGTTAAGAGAAGTCTGGAGG + Intronic
1011956198 6:93028118-93028140 AAAAATTTTGTTACGTTTGGGGG + Intergenic
1012286772 6:97399897-97399919 AGAAGATTTGTGGAGTTTGGTGG + Intergenic
1012867250 6:104633104-104633126 AATACTTTTGTGTACTCTGGAGG + Intergenic
1014294895 6:119606050-119606072 AATGGTTTCCTGAAGTCTGGAGG + Intergenic
1015593895 6:134848038-134848060 AAATGATTTGTCAAGTCTGGTGG + Intergenic
1016695045 6:146984431-146984453 AAGAGAGATGTGAAGTCTGGAGG - Intergenic
1018406504 6:163489347-163489369 CAAAGTTTTGTGAAGCTGGGGGG - Intronic
1018607797 6:165616826-165616848 AAATGTTTTGTGAAAACTGGTGG - Intronic
1020637596 7:10715184-10715206 ATAAGTCTTGTGAAATCTGTTGG - Intergenic
1020742310 7:12037289-12037311 AAAAGTTTTTGGAATCCTGGAGG - Intergenic
1022857022 7:34324849-34324871 AAGAGGTTTGTGAATTCTTGGGG - Intergenic
1022967926 7:35491024-35491046 AAAAGATATGAGAAGTCAGGAGG + Intergenic
1023901432 7:44483672-44483694 ATAAGTTTTGTAAAGACAGGAGG - Intronic
1024714606 7:52061892-52061914 CAAAGTTTTTTGTGGTCTGGGGG - Intergenic
1026051819 7:66953114-66953136 AAAAGTTGTGGCAAGTCTGGAGG + Intronic
1026153269 7:67806165-67806187 AAAAGATTTGCCAAGTGTGGTGG + Intergenic
1026235756 7:68525747-68525769 AAATGTAGTGTGAATTCTGGAGG - Intergenic
1028897460 7:96058568-96058590 AAACAGTTTGTGAAGTCGGGGGG - Intronic
1029316706 7:99722295-99722317 AAAAGTATAGAAAAGTCTGGGGG - Exonic
1030131598 7:106206338-106206360 AAATGTTTTGTGGAGGGTGGGGG + Intergenic
1032293920 7:130617451-130617473 AAAAGTTATGTCTAGTCTGATGG - Intronic
1032979453 7:137265007-137265029 AAAAGTTTTGTCAGGTCAGGTGG + Intronic
1032981285 7:137286161-137286183 ATCAGTATTGTGAAGTCTGTGGG - Intronic
1034406702 7:150908795-150908817 AAAGATTTTGGGAAGGCTGGAGG - Intergenic
1036942524 8:13065270-13065292 AAGGGGTTTGTCAAGTCTGGAGG + Intergenic
1038260460 8:25988742-25988764 AAATGTCTTGTGAATGCTGGAGG - Intronic
1038566797 8:28626289-28626311 AAAAGTCTTGTAAAGGCAGGGGG + Intronic
1039920416 8:41890033-41890055 AATGGTATTGTGAAGTCTTGAGG - Intronic
1041147785 8:54896166-54896188 AAAAGTTTTGGGGATTCTTGAGG + Intergenic
1041163163 8:55065438-55065460 AAGATTCATGTGAAGTCTGGAGG + Intergenic
1043274029 8:78371038-78371060 AAAAGTTTGGTGCAGTGTGGAGG - Intergenic
1043402963 8:79901896-79901918 AAAATATATGTGAAGTCTGCTGG - Intergenic
1043520059 8:81035111-81035133 AATAGGTTGGTGAAGTCAGGAGG + Intronic
1043740399 8:83803436-83803458 AAAATTTATGTAAAATCTGGAGG - Intergenic
1043866917 8:85385242-85385264 ACAATATTTGTGAAGTCTGAAGG - Intronic
1044091485 8:88007858-88007880 ATAAGTTTTGAGAAGTGTGGTGG + Intergenic
1045017069 8:98009523-98009545 GAAAGTTCTCTGAAGTGTGGAGG + Intronic
1047047724 8:121073574-121073596 GAAAGTTATGTGAAGACTCGGGG + Intergenic
1049453912 8:142677400-142677422 GAATGTTTGGTGATGTCTGGAGG - Intronic
1049971434 9:825442-825464 AAAAATTTTGCCAAGTGTGGTGG + Intergenic
1053132171 9:35622008-35622030 AAGAGTTTCGTGAACTGTGGAGG + Intronic
1054973880 9:71120691-71120713 AAAAGCTTTGTGTAGTTAGGTGG - Intronic
1058768546 9:108207571-108207593 AAATGTTTTGTGATGTATGTGGG + Intergenic
1059047301 9:110882988-110883010 AAAAGTTTTGTCTTGTTTGGGGG + Intronic
1059556532 9:115286313-115286335 AAAAGTTTGGTCAATTTTGGAGG + Intronic
1060254694 9:122016936-122016958 AAAATTTTTGTGAAGAGTCGAGG - Intronic
1060401871 9:123354200-123354222 AAGTGTCTTGTGAGGTCTGGAGG - Intergenic
1194233419 X:91351987-91352009 AAAATTATTGTGAAGTCTAATGG - Intergenic
1196770002 X:119283696-119283718 AAAATTTTTTTAAAGTCTTGGGG + Intergenic
1197179621 X:123520341-123520363 AAAAGTGTTGGAAAGGCTGGAGG - Intergenic
1199720897 X:150542156-150542178 AAAAGTTTGGCAAAGGCTGGGGG + Intergenic
1201984069 Y:19943842-19943864 AAATTTTTTGTGAAGTCTTTAGG + Intergenic
1202103153 Y:21331568-21331590 AAAAATTTTGCCAGGTCTGGCGG - Intergenic
1202349132 Y:23968769-23968791 AAAAGTTTTGTTAGAGCTGGGGG + Intergenic
1202521643 Y:25701335-25701357 AAAAGTTTTGTTAGAGCTGGGGG - Intergenic