ID: 1138321236

View in Genome Browser
Species Human (GRCh38)
Location 16:56113889-56113911
Sequence CTGAGAGACAGCAGGGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138321236_1138321241 -3 Left 1138321236 16:56113889-56113911 CCAGCTACCCTGCTGTCTCTCAG No data
Right 1138321241 16:56113909-56113931 CAGGGTAATCAAAAGTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138321236 Original CRISPR CTGAGAGACAGCAGGGTAGC TGG (reversed) Intergenic
No off target data available for this crispr