ID: 1138321239

View in Genome Browser
Species Human (GRCh38)
Location 16:56113896-56113918
Sequence GATTACCCTGAGAGACAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138321239_1138321241 -10 Left 1138321239 16:56113896-56113918 CCCTGCTGTCTCTCAGGGTAATC No data
Right 1138321241 16:56113909-56113931 CAGGGTAATCAAAAGTATTCTGG No data
1138321239_1138321242 25 Left 1138321239 16:56113896-56113918 CCCTGCTGTCTCTCAGGGTAATC No data
Right 1138321242 16:56113944-56113966 GCATTTAAAATTTTCGCGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138321239 Original CRISPR GATTACCCTGAGAGACAGCA GGG (reversed) Intergenic
No off target data available for this crispr