ID: 1138321241 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:56113909-56113931 |
| Sequence | CAGGGTAATCAAAAGTATTC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1138321236_1138321241 | -3 | Left | 1138321236 | 16:56113889-56113911 | CCAGCTACCCTGCTGTCTCTCAG | No data | ||
| Right | 1138321241 | 16:56113909-56113931 | CAGGGTAATCAAAAGTATTCTGG | No data | ||||
| 1138321239_1138321241 | -10 | Left | 1138321239 | 16:56113896-56113918 | CCCTGCTGTCTCTCAGGGTAATC | No data | ||
| Right | 1138321241 | 16:56113909-56113931 | CAGGGTAATCAAAAGTATTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1138321241 | Original CRISPR | CAGGGTAATCAAAAGTATTC TGG | Intergenic | ||
| No off target data available for this crispr | |||||