ID: 1138326495

View in Genome Browser
Species Human (GRCh38)
Location 16:56175676-56175698
Sequence CTCAATTTAAAAATGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138326495_1138326497 26 Left 1138326495 16:56175676-56175698 CCTTTGTCCATTTTTAAATTGAG No data
Right 1138326497 16:56175725-56175747 TAAGAGTTATTTATATATTCTGG 0: 11
1: 251
2: 793
3: 1879
4: 3726

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138326495 Original CRISPR CTCAATTTAAAAATGGACAA AGG (reversed) Intergenic
No off target data available for this crispr