ID: 1138327955

View in Genome Browser
Species Human (GRCh38)
Location 16:56191299-56191321
Sequence CCCCGGGACGGGGAGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138327955_1138327974 19 Left 1138327955 16:56191299-56191321 CCCGCGCCCTCCCCGTCCCGGGG No data
Right 1138327974 16:56191341-56191363 TGACGTCAGCTGGCGGCCCGCGG No data
1138327955_1138327971 12 Left 1138327955 16:56191299-56191321 CCCGCGCCCTCCCCGTCCCGGGG No data
Right 1138327971 16:56191334-56191356 GCCCTGCTGACGTCAGCTGGCGG No data
1138327955_1138327970 9 Left 1138327955 16:56191299-56191321 CCCGCGCCCTCCCCGTCCCGGGG No data
Right 1138327970 16:56191331-56191353 GCGGCCCTGCTGACGTCAGCTGG No data
1138327955_1138327975 25 Left 1138327955 16:56191299-56191321 CCCGCGCCCTCCCCGTCCCGGGG No data
Right 1138327975 16:56191347-56191369 CAGCTGGCGGCCCGCGGAGCCGG No data
1138327955_1138327965 -10 Left 1138327955 16:56191299-56191321 CCCGCGCCCTCCCCGTCCCGGGG No data
Right 1138327965 16:56191312-56191334 CGTCCCGGGGGCCCGGCGCGCGG No data
1138327955_1138327976 26 Left 1138327955 16:56191299-56191321 CCCGCGCCCTCCCCGTCCCGGGG No data
Right 1138327976 16:56191348-56191370 AGCTGGCGGCCCGCGGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138327955 Original CRISPR CCCCGGGACGGGGAGGGCGC GGG (reversed) Intergenic
No off target data available for this crispr