ID: 1138327961

View in Genome Browser
Species Human (GRCh38)
Location 16:56191306-56191328
Sequence GCCGGGCCCCCGGGACGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138327961_1138327976 19 Left 1138327961 16:56191306-56191328 CCTCCCCGTCCCGGGGGCCCGGC No data
Right 1138327976 16:56191348-56191370 AGCTGGCGGCCCGCGGAGCCGGG No data
1138327961_1138327971 5 Left 1138327961 16:56191306-56191328 CCTCCCCGTCCCGGGGGCCCGGC No data
Right 1138327971 16:56191334-56191356 GCCCTGCTGACGTCAGCTGGCGG No data
1138327961_1138327970 2 Left 1138327961 16:56191306-56191328 CCTCCCCGTCCCGGGGGCCCGGC No data
Right 1138327970 16:56191331-56191353 GCGGCCCTGCTGACGTCAGCTGG No data
1138327961_1138327975 18 Left 1138327961 16:56191306-56191328 CCTCCCCGTCCCGGGGGCCCGGC No data
Right 1138327975 16:56191347-56191369 CAGCTGGCGGCCCGCGGAGCCGG No data
1138327961_1138327974 12 Left 1138327961 16:56191306-56191328 CCTCCCCGTCCCGGGGGCCCGGC No data
Right 1138327974 16:56191341-56191363 TGACGTCAGCTGGCGGCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138327961 Original CRISPR GCCGGGCCCCCGGGACGGGG AGG (reversed) Intergenic
No off target data available for this crispr