ID: 1138327964

View in Genome Browser
Species Human (GRCh38)
Location 16:56191311-56191333
Sequence CGCGCGCCGGGCCCCCGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138327964_1138327979 30 Left 1138327964 16:56191311-56191333 CCGTCCCGGGGGCCCGGCGCGCG No data
Right 1138327979 16:56191364-56191386 AGCCGGGTGCGCAGAGCCGCTGG No data
1138327964_1138327976 14 Left 1138327964 16:56191311-56191333 CCGTCCCGGGGGCCCGGCGCGCG No data
Right 1138327976 16:56191348-56191370 AGCTGGCGGCCCGCGGAGCCGGG No data
1138327964_1138327975 13 Left 1138327964 16:56191311-56191333 CCGTCCCGGGGGCCCGGCGCGCG No data
Right 1138327975 16:56191347-56191369 CAGCTGGCGGCCCGCGGAGCCGG No data
1138327964_1138327971 0 Left 1138327964 16:56191311-56191333 CCGTCCCGGGGGCCCGGCGCGCG No data
Right 1138327971 16:56191334-56191356 GCCCTGCTGACGTCAGCTGGCGG No data
1138327964_1138327974 7 Left 1138327964 16:56191311-56191333 CCGTCCCGGGGGCCCGGCGCGCG No data
Right 1138327974 16:56191341-56191363 TGACGTCAGCTGGCGGCCCGCGG No data
1138327964_1138327970 -3 Left 1138327964 16:56191311-56191333 CCGTCCCGGGGGCCCGGCGCGCG No data
Right 1138327970 16:56191331-56191353 GCGGCCCTGCTGACGTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138327964 Original CRISPR CGCGCGCCGGGCCCCCGGGA CGG (reversed) Intergenic
No off target data available for this crispr