ID: 1138327971

View in Genome Browser
Species Human (GRCh38)
Location 16:56191334-56191356
Sequence GCCCTGCTGACGTCAGCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138327951_1138327971 16 Left 1138327951 16:56191295-56191317 CCGCCCCGCGCCCTCCCCGTCCC No data
Right 1138327971 16:56191334-56191356 GCCCTGCTGACGTCAGCTGGCGG No data
1138327964_1138327971 0 Left 1138327964 16:56191311-56191333 CCGTCCCGGGGGCCCGGCGCGCG No data
Right 1138327971 16:56191334-56191356 GCCCTGCTGACGTCAGCTGGCGG No data
1138327966_1138327971 -4 Left 1138327966 16:56191315-56191337 CCCGGGGGCCCGGCGCGCGGCCC No data
Right 1138327971 16:56191334-56191356 GCCCTGCTGACGTCAGCTGGCGG No data
1138327947_1138327971 22 Left 1138327947 16:56191289-56191311 CCTCCCCCGCCCCGCGCCCTCCC No data
Right 1138327971 16:56191334-56191356 GCCCTGCTGACGTCAGCTGGCGG No data
1138327948_1138327971 19 Left 1138327948 16:56191292-56191314 CCCCCGCCCCGCGCCCTCCCCGT No data
Right 1138327971 16:56191334-56191356 GCCCTGCTGACGTCAGCTGGCGG No data
1138327955_1138327971 12 Left 1138327955 16:56191299-56191321 CCCGCGCCCTCCCCGTCCCGGGG No data
Right 1138327971 16:56191334-56191356 GCCCTGCTGACGTCAGCTGGCGG No data
1138327967_1138327971 -5 Left 1138327967 16:56191316-56191338 CCGGGGGCCCGGCGCGCGGCCCT No data
Right 1138327971 16:56191334-56191356 GCCCTGCTGACGTCAGCTGGCGG No data
1138327962_1138327971 2 Left 1138327962 16:56191309-56191331 CCCCGTCCCGGGGGCCCGGCGCG No data
Right 1138327971 16:56191334-56191356 GCCCTGCTGACGTCAGCTGGCGG No data
1138327950_1138327971 17 Left 1138327950 16:56191294-56191316 CCCGCCCCGCGCCCTCCCCGTCC No data
Right 1138327971 16:56191334-56191356 GCCCTGCTGACGTCAGCTGGCGG No data
1138327957_1138327971 11 Left 1138327957 16:56191300-56191322 CCGCGCCCTCCCCGTCCCGGGGG No data
Right 1138327971 16:56191334-56191356 GCCCTGCTGACGTCAGCTGGCGG No data
1138327961_1138327971 5 Left 1138327961 16:56191306-56191328 CCTCCCCGTCCCGGGGGCCCGGC No data
Right 1138327971 16:56191334-56191356 GCCCTGCTGACGTCAGCTGGCGG No data
1138327949_1138327971 18 Left 1138327949 16:56191293-56191315 CCCCGCCCCGCGCCCTCCCCGTC No data
Right 1138327971 16:56191334-56191356 GCCCTGCTGACGTCAGCTGGCGG No data
1138327953_1138327971 13 Left 1138327953 16:56191298-56191320 CCCCGCGCCCTCCCCGTCCCGGG No data
Right 1138327971 16:56191334-56191356 GCCCTGCTGACGTCAGCTGGCGG No data
1138327959_1138327971 6 Left 1138327959 16:56191305-56191327 CCCTCCCCGTCCCGGGGGCCCGG No data
Right 1138327971 16:56191334-56191356 GCCCTGCTGACGTCAGCTGGCGG No data
1138327963_1138327971 1 Left 1138327963 16:56191310-56191332 CCCGTCCCGGGGGCCCGGCGCGC No data
Right 1138327971 16:56191334-56191356 GCCCTGCTGACGTCAGCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138327971 Original CRISPR GCCCTGCTGACGTCAGCTGG CGG Intergenic
No off target data available for this crispr