ID: 1138327972

View in Genome Browser
Species Human (GRCh38)
Location 16:56191335-56191357
Sequence GCCGCCAGCTGACGTCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138327972_1138327979 6 Left 1138327972 16:56191335-56191357 CCCTGCTGACGTCAGCTGGCGGC No data
Right 1138327979 16:56191364-56191386 AGCCGGGTGCGCAGAGCCGCTGG No data
1138327972_1138327982 27 Left 1138327972 16:56191335-56191357 CCCTGCTGACGTCAGCTGGCGGC No data
Right 1138327982 16:56191385-56191407 GGCGCACTCGCGCGCTGCGCTGG 0: 1
1: 0
2: 2
3: 6
4: 55
1138327972_1138327976 -10 Left 1138327972 16:56191335-56191357 CCCTGCTGACGTCAGCTGGCGGC No data
Right 1138327976 16:56191348-56191370 AGCTGGCGGCCCGCGGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138327972 Original CRISPR GCCGCCAGCTGACGTCAGCA GGG (reversed) Intergenic
No off target data available for this crispr