ID: 1138327976

View in Genome Browser
Species Human (GRCh38)
Location 16:56191348-56191370
Sequence AGCTGGCGGCCCGCGGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138327968_1138327976 2 Left 1138327968 16:56191323-56191345 CCCGGCGCGCGGCCCTGCTGACG No data
Right 1138327976 16:56191348-56191370 AGCTGGCGGCCCGCGGAGCCGGG No data
1138327963_1138327976 15 Left 1138327963 16:56191310-56191332 CCCGTCCCGGGGGCCCGGCGCGC No data
Right 1138327976 16:56191348-56191370 AGCTGGCGGCCCGCGGAGCCGGG No data
1138327961_1138327976 19 Left 1138327961 16:56191306-56191328 CCTCCCCGTCCCGGGGGCCCGGC No data
Right 1138327976 16:56191348-56191370 AGCTGGCGGCCCGCGGAGCCGGG No data
1138327967_1138327976 9 Left 1138327967 16:56191316-56191338 CCGGGGGCCCGGCGCGCGGCCCT No data
Right 1138327976 16:56191348-56191370 AGCTGGCGGCCCGCGGAGCCGGG No data
1138327972_1138327976 -10 Left 1138327972 16:56191335-56191357 CCCTGCTGACGTCAGCTGGCGGC No data
Right 1138327976 16:56191348-56191370 AGCTGGCGGCCCGCGGAGCCGGG No data
1138327966_1138327976 10 Left 1138327966 16:56191315-56191337 CCCGGGGGCCCGGCGCGCGGCCC No data
Right 1138327976 16:56191348-56191370 AGCTGGCGGCCCGCGGAGCCGGG No data
1138327951_1138327976 30 Left 1138327951 16:56191295-56191317 CCGCCCCGCGCCCTCCCCGTCCC No data
Right 1138327976 16:56191348-56191370 AGCTGGCGGCCCGCGGAGCCGGG No data
1138327969_1138327976 1 Left 1138327969 16:56191324-56191346 CCGGCGCGCGGCCCTGCTGACGT No data
Right 1138327976 16:56191348-56191370 AGCTGGCGGCCCGCGGAGCCGGG No data
1138327957_1138327976 25 Left 1138327957 16:56191300-56191322 CCGCGCCCTCCCCGTCCCGGGGG No data
Right 1138327976 16:56191348-56191370 AGCTGGCGGCCCGCGGAGCCGGG No data
1138327964_1138327976 14 Left 1138327964 16:56191311-56191333 CCGTCCCGGGGGCCCGGCGCGCG No data
Right 1138327976 16:56191348-56191370 AGCTGGCGGCCCGCGGAGCCGGG No data
1138327962_1138327976 16 Left 1138327962 16:56191309-56191331 CCCCGTCCCGGGGGCCCGGCGCG No data
Right 1138327976 16:56191348-56191370 AGCTGGCGGCCCGCGGAGCCGGG No data
1138327959_1138327976 20 Left 1138327959 16:56191305-56191327 CCCTCCCCGTCCCGGGGGCCCGG No data
Right 1138327976 16:56191348-56191370 AGCTGGCGGCCCGCGGAGCCGGG No data
1138327953_1138327976 27 Left 1138327953 16:56191298-56191320 CCCCGCGCCCTCCCCGTCCCGGG No data
Right 1138327976 16:56191348-56191370 AGCTGGCGGCCCGCGGAGCCGGG No data
1138327955_1138327976 26 Left 1138327955 16:56191299-56191321 CCCGCGCCCTCCCCGTCCCGGGG No data
Right 1138327976 16:56191348-56191370 AGCTGGCGGCCCGCGGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138327976 Original CRISPR AGCTGGCGGCCCGCGGAGCC GGG Intergenic
No off target data available for this crispr