ID: 1138327992

View in Genome Browser
Species Human (GRCh38)
Location 16:56191420-56191442
Sequence GCGCGCGCGCGCCTGGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 1, 2: 6, 3: 48, 4: 328}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138327992 Original CRISPR GCGCGCGCGCGCCTGGGCCC GGG (reversed) Intronic