ID: 1138328500

View in Genome Browser
Species Human (GRCh38)
Location 16:56193706-56193728
Sequence CCCACAGGCAGGTTTGCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138328493_1138328500 -1 Left 1138328493 16:56193684-56193706 CCACTCGGCAGTTCCTGGTGATC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 1138328500 16:56193706-56193728 CCCACAGGCAGGTTTGCTTGGGG 0: 1
1: 0
2: 1
3: 20
4: 173
1138328491_1138328500 4 Left 1138328491 16:56193679-56193701 CCTATCCACTCGGCAGTTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1138328500 16:56193706-56193728 CCCACAGGCAGGTTTGCTTGGGG 0: 1
1: 0
2: 1
3: 20
4: 173
1138328488_1138328500 27 Left 1138328488 16:56193656-56193678 CCACTTGCAGGCTCGCTTCTTGC 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1138328500 16:56193706-56193728 CCCACAGGCAGGTTTGCTTGGGG 0: 1
1: 0
2: 1
3: 20
4: 173
1138328490_1138328500 5 Left 1138328490 16:56193678-56193700 CCCTATCCACTCGGCAGTTCCTG 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1138328500 16:56193706-56193728 CCCACAGGCAGGTTTGCTTGGGG 0: 1
1: 0
2: 1
3: 20
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138328500 Original CRISPR CCCACAGGCAGGTTTGCTTG GGG Intronic