ID: 1138330486

View in Genome Browser
Species Human (GRCh38)
Location 16:56211397-56211419
Sequence TAGGAGGCCCAGGGAGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 249}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138330486_1138330500 25 Left 1138330486 16:56211397-56211419 CCCAGAACTCCCTGGGCCTCCTA 0: 1
1: 0
2: 0
3: 27
4: 249
Right 1138330500 16:56211445-56211467 TCCCCTCCCAGCCCAGCTCTGGG 0: 1
1: 0
2: 9
3: 73
4: 612
1138330486_1138330493 1 Left 1138330486 16:56211397-56211419 CCCAGAACTCCCTGGGCCTCCTA 0: 1
1: 0
2: 0
3: 27
4: 249
Right 1138330493 16:56211421-56211443 CTCCAGCTATGCCGTCCTCCAGG 0: 1
1: 0
2: 3
3: 23
4: 162
1138330486_1138330494 2 Left 1138330486 16:56211397-56211419 CCCAGAACTCCCTGGGCCTCCTA 0: 1
1: 0
2: 0
3: 27
4: 249
Right 1138330494 16:56211422-56211444 TCCAGCTATGCCGTCCTCCAGGG 0: 1
1: 0
2: 0
3: 12
4: 88
1138330486_1138330502 26 Left 1138330486 16:56211397-56211419 CCCAGAACTCCCTGGGCCTCCTA 0: 1
1: 0
2: 0
3: 27
4: 249
Right 1138330502 16:56211446-56211468 CCCCTCCCAGCCCAGCTCTGGGG 0: 1
1: 0
2: 11
3: 112
4: 760
1138330486_1138330499 24 Left 1138330486 16:56211397-56211419 CCCAGAACTCCCTGGGCCTCCTA 0: 1
1: 0
2: 0
3: 27
4: 249
Right 1138330499 16:56211444-56211466 GTCCCCTCCCAGCCCAGCTCTGG 0: 1
1: 0
2: 7
3: 74
4: 594

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138330486 Original CRISPR TAGGAGGCCCAGGGAGTTCT GGG (reversed) Intronic
900338064 1:2174571-2174593 CAGGAGGCCCAGGGAGGACCCGG + Intronic
901456531 1:9366239-9366261 GAGAAGGCCCAGGCAGCTCTGGG + Intronic
901758418 1:11455391-11455413 ACTGAGGCCCAGGGAGGTCTAGG + Intergenic
903365400 1:22802666-22802688 CAGGAGGTCCAGGGAGTTGGGGG - Intronic
904377629 1:30091722-30091744 GAGGAGGCACAGGGAGATTTGGG + Intergenic
904556927 1:31371432-31371454 TAGGAGACTCAGGGAGATCTGGG + Intronic
904819807 1:33234640-33234662 CAGGAGGAACAGGGAGGTCTAGG + Intergenic
905614730 1:39387869-39387891 TCAGAGGCTCAGGGAGTTCCAGG + Exonic
905831653 1:41073918-41073940 TAGAATGCCCAGGGAGAACTGGG + Intronic
906070813 1:43015159-43015181 CAGGAAGCCCAGGAAGTCCTGGG - Intergenic
906967513 1:50472940-50472962 TAGGAGGCCTAAAGAGTCCTGGG + Intronic
907046862 1:51304919-51304941 ACTGAGGCCCAGGGAGGTCTGGG + Intronic
907308694 1:53527485-53527507 CAGGAGGCCCAGGGAGGCCAGGG + Intronic
907355157 1:53866397-53866419 AAGGAGGAGCGGGGAGTTCTTGG + Intronic
911990513 1:104691161-104691183 TAGTAGGCCCATGTAGTTCAAGG - Intergenic
912464745 1:109864124-109864146 TGGGAGGCCATGTGAGTTCTTGG + Intergenic
913445596 1:118947265-118947287 TGGGAGGACCAGGAGGTTCTTGG - Intronic
915526406 1:156479068-156479090 ATGGAGGCTCAGGGAATTCTGGG - Intronic
916599242 1:166276155-166276177 CAGGAGGCCCAGGAAGTCCTGGG - Intergenic
917125632 1:171685013-171685035 CTGCAGGTCCAGGGAGTTCTGGG + Intergenic
920333778 1:205230397-205230419 TGCCAGGCCCAGGGAGTCCTTGG + Intronic
920500660 1:206483027-206483049 CAGGAGGGCCAGGGAGCTTTGGG - Intronic
920846295 1:209595688-209595710 TTTGAGGCCCAGGGAGCTCGTGG + Intronic
921111591 1:212043532-212043554 TAGGACGCCAAGGTAGGTCTGGG + Intronic
922654003 1:227365000-227365022 TAGGATGGCCAGGTAGTACTTGG + Intergenic
922757851 1:228106378-228106400 TAGGAGGGGCTGGGTGTTCTGGG - Intergenic
923215609 1:231845509-231845531 AAGGTGGCCCAGTGACTTCTGGG + Intronic
923461503 1:234213400-234213422 CACAAGGCCCTGGGAGTTCTGGG + Intronic
923804273 1:237241510-237241532 CAGGAGGCCAAGTGGGTTCTTGG + Intronic
924707717 1:246512494-246512516 AAGGAGGCCCAGGGAGACCCTGG - Intergenic
924740568 1:246792150-246792172 TAGGTGGCCCGGGGAGACCTGGG + Intergenic
1064621060 10:17217790-17217812 GAGGAGGCTCAGGGAATTATAGG - Intergenic
1065787564 10:29230374-29230396 TAGGAGGCAGAGGGGGTTCGGGG - Intergenic
1066612591 10:37265580-37265602 AAGGAGGCCCAGGCAGGCCTGGG - Intronic
1067222755 10:44355870-44355892 ATGGAGGCCCAGAGAGCTCTAGG + Intergenic
1067449179 10:46370938-46370960 TAGGATGCCCAGGGATGTATAGG + Intronic
1067588191 10:47489827-47489849 TAGGATGCCCAGGGATGTATAGG - Intronic
1067635315 10:47997918-47997940 TAGGATGCCCAGGGATGTATAGG - Intergenic
1068699726 10:60007040-60007062 GAGGAAGCCCAGGGAGGTCGAGG - Intergenic
1069815050 10:71188442-71188464 CAGGAGGCAGAGGGAGTGCTAGG - Intergenic
1070284214 10:75071677-75071699 GAGGAGGGCCAGGAAGTGCTGGG + Intergenic
1070561637 10:77571863-77571885 TAGAAGGCCCTGGGAACTCTGGG - Intronic
1070705180 10:78632281-78632303 GAAGAGGCCCAGGGACTTCATGG - Intergenic
1075714980 10:124550796-124550818 TAGCAGGCCCACAGAGGTCTGGG + Intronic
1079449023 11:20583245-20583267 GAGGAGCCCAAGGGTGTTCTGGG + Intergenic
1081307569 11:41532246-41532268 GATGAGGCAAAGGGAGTTCTGGG - Intergenic
1081864931 11:46354151-46354173 TGGTAGACCCAGGGAGCTCTAGG + Intronic
1081882070 11:46462162-46462184 TAGCAGGTCCAGGGTTTTCTGGG - Intronic
1082938214 11:58676165-58676187 TATTAGGCCCACGGGGTTCTTGG + Intronic
1083730521 11:64650143-64650165 TTGGAGGCCCAGGAGGTCCTTGG + Intronic
1084025350 11:66444928-66444950 TAGGAGGCCACGTGGGTTCTTGG + Intronic
1084030449 11:66477780-66477802 TAGAAGGCCCAGGGAGGACCTGG + Intergenic
1084207016 11:67601119-67601141 ACGGAGGACCAGGGAGGTCTTGG - Intergenic
1084208229 11:67608356-67608378 CAGGAGGCCCAGAGTGCTCTGGG - Intronic
1084501054 11:69535717-69535739 TATGATGCCCAGGCTGTTCTTGG + Intergenic
1084509818 11:69596585-69596607 CATGAGGTCCTGGGAGTTCTGGG - Intergenic
1085084401 11:73657191-73657213 TTGGTGGCCCAGGCACTTCTAGG - Intronic
1087186540 11:95204618-95204640 GAAGAGGGCCAGGGAGCTCTTGG - Intronic
1089350077 11:117817120-117817142 TAGGAAGCCCAGGGAGGGCCAGG - Intronic
1091173605 11:133540417-133540439 TGGGAGGATCAGGGAATTCTGGG + Intergenic
1093847774 12:23995049-23995071 TAGAAGCACCAGGGACTTCTTGG - Intergenic
1094646545 12:32330002-32330024 TAGTAGGTCAAGGGAGCTCTTGG + Intronic
1094844036 12:34353687-34353709 TGGGAGGCCCAGGGTGCCCTGGG + Intergenic
1095809499 12:46356834-46356856 TTGGAAGCCCAGGGAGGTCAAGG - Intergenic
1095915785 12:47476267-47476289 TAGGAAGCCCAGTGAGATCCAGG + Intergenic
1096122690 12:49098361-49098383 TAGTAGGCCCTGGGAGTTCCTGG - Intronic
1098351583 12:69567602-69567624 TAGGAAGCCCAGGGTGCTTTGGG + Intronic
1099827788 12:87800352-87800374 TAAGAGAGACAGGGAGTTCTTGG - Intergenic
1101111465 12:101490789-101490811 GATCAGGCCCAGGGAGCTCTTGG - Intergenic
1101881985 12:108631951-108631973 CAGGATGCCCATGGAGTTCGTGG - Exonic
1102255175 12:111410839-111410861 AAGGAGGCCCAGAGAGTTGTGGG - Intronic
1103983995 12:124755144-124755166 TGGGAGGCCCAGGCAGGGCTGGG - Intergenic
1104859323 12:131916435-131916457 TAGGAGGGCCAGCAGGTTCTGGG - Exonic
1105807120 13:23959973-23959995 TAGCAGGCCTATGGAGTCCTGGG - Intergenic
1106227125 13:27793975-27793997 TCCGAGGCGCAGGGAGGTCTTGG - Exonic
1110804612 13:79739662-79739684 TAGGAGGCCCATGGAAATCTTGG - Intergenic
1111404555 13:87785676-87785698 TGGGATGCCCTGGGTGTTCTGGG - Intergenic
1112033716 13:95478872-95478894 AAGGAGCCTCAGGGAGTTATAGG + Intronic
1113604645 13:111596592-111596614 CAGGAGGGCCAGGGAGGTCCTGG - Intronic
1113797446 13:113066701-113066723 GGGGAGGCTCGGGGAGTTCTCGG - Intronic
1113804126 13:113103717-113103739 GAGGAGGTCCCGGGAGTCCTGGG + Intergenic
1113945624 13:114042606-114042628 TAGGAGGCCCAGGCCGCTCCCGG - Intronic
1114668581 14:24396982-24397004 GAGGAAGCCCATGGAGTTCAAGG + Intergenic
1114774025 14:25460987-25461009 TAGCAGGGACAGGGAGTTCTTGG + Intergenic
1117511181 14:56453130-56453152 TAGGAGGCCCAGGCAGGCCCTGG - Intergenic
1117555449 14:56878769-56878791 TAGGAGACTCAGTGAGATCTAGG + Intergenic
1118137447 14:63045369-63045391 GAGGAGGACCAGGCAGTTCATGG + Exonic
1118346410 14:64944378-64944400 CTGGAGGCCCAGAGAGTACTAGG - Intronic
1121162927 14:91761755-91761777 TAAGAGGCCCAGTGAACTCTAGG + Intronic
1122194113 14:100072306-100072328 CAGGAGGCACAGGGAGGTGTAGG - Intronic
1122353751 14:101111745-101111767 GAGGAGGCTCAGGGTGTCCTGGG - Intergenic
1122412267 14:101531693-101531715 TTGGAGGGCTAGGGAGATCTGGG + Intergenic
1122636367 14:103131668-103131690 CAGGAGGCTCAGGGTGTCCTGGG - Exonic
1122681124 14:103464085-103464107 GAAGAGGCACAGGGAGTTGTGGG - Intronic
1122694906 14:103547750-103547772 CAGCAGGCCCAGGGTGCTCTTGG - Intergenic
1122783692 14:104154403-104154425 CAGGAGGCCCTGGGAGCCCTGGG - Intronic
1202860764 14_GL000225v1_random:79728-79750 TCGGAGGAGCAGGGTGTTCTGGG + Intergenic
1124420156 15:29514025-29514047 TAGGGGGAGCAGGGAGTGCTGGG + Intronic
1129341007 15:74886683-74886705 AATGAGGCTCAAGGAGTTCTTGG - Intergenic
1129937571 15:79463425-79463447 TTGGGGGCCCAGGGAGTTGAAGG - Intronic
1130219742 15:82009522-82009544 TAGGAGGCCCTGGGGGTGTTGGG - Intergenic
1130801111 15:87264261-87264283 CAGGAGGCCATGGGGGTTCTTGG - Intergenic
1131369498 15:91867804-91867826 GCGGAGGCCCCGGGTGTTCTGGG + Intronic
1133233999 16:4379287-4379309 TATGAGGCTCAGGGACTTCTAGG + Intronic
1134346696 16:13398167-13398189 GTGGTGGCCCAGGGTGTTCTTGG + Intergenic
1134506741 16:14813782-14813804 TAGGTGGGGCAGGGGGTTCTGGG + Intronic
1134728603 16:16441279-16441301 TAGGTGGGGCAGGGGGTTCTGGG + Intergenic
1134938839 16:18270639-18270661 TAGGTGGGGCAGGGGGTTCTGGG - Intergenic
1137592941 16:49704903-49704925 GAGGGAGCCCAGGGAGTTCTAGG - Intronic
1137905626 16:52319167-52319189 TAGGGGGCACGGGGAGCTCTGGG + Intergenic
1138279212 16:55760461-55760483 CTGGAAGCCCAGGGAGATCTGGG + Intergenic
1138330486 16:56211397-56211419 TAGGAGGCCCAGGGAGTTCTGGG - Intronic
1141638719 16:85329115-85329137 TGGGGGGCCCAGGGAGCTGTGGG - Intergenic
1141766717 16:86063865-86063887 TAGCAGCCGCAGGGAGTTGTGGG + Intergenic
1141819435 16:86434812-86434834 GAGGGGGCCGAGGGAGTCCTAGG + Intergenic
1142974992 17:3637946-3637968 CAGGAGACCCAGGGAGTTCCAGG + Intronic
1146054873 17:29576016-29576038 TCTGAGCCCCAGGGGGTTCTGGG - Intronic
1147340067 17:39748025-39748047 TAGGGGGCACAGGGACTTGTTGG - Intergenic
1148360825 17:47010717-47010739 CAGGTGGCCTAGGGATTTCTGGG - Intronic
1150621329 17:66809804-66809826 TAGGATTCCCAGGGGTTTCTGGG + Exonic
1151384131 17:73744793-73744815 TATTAGGCCCAGGGAGCTGTGGG + Intergenic
1151824016 17:76513520-76513542 TTGGTGGCCCCAGGAGTTCTTGG - Intergenic
1152242149 17:79166308-79166330 AAGGAGGCCCGGGCAGTTGTGGG + Intronic
1152794183 17:82298776-82298798 CAGGGGGCCCAGGGAGCTCCGGG + Intergenic
1153555699 18:6311018-6311040 CAGGAGGCCCAGGGAGGAGTTGG - Intronic
1156737450 18:40277841-40277863 TGGTAGGCCCAGGCATTTCTTGG - Intergenic
1160106967 18:75987362-75987384 TAGTAGACCCTGGGACTTCTAGG - Intergenic
1161314797 19:3612789-3612811 GAGGCTGCCCAGGGAGTGCTCGG + Intronic
1162523583 19:11195286-11195308 GTGGAGGCCCAGGAAGTCCTGGG + Intronic
1163118155 19:15200411-15200433 TTGGGGGCCCAGGTACTTCTAGG - Intronic
1163741507 19:19016449-19016471 TAGGAGGCCCTGAGAGGCCTGGG - Intronic
1163842730 19:19621202-19621224 TAGAAGGACCTGGGAGTTTTGGG + Intergenic
1164484565 19:28643726-28643748 CTGGAGCTCCAGGGAGTTCTGGG - Intergenic
1164982737 19:32626530-32626552 CAGGAGACCCCGGGAGTCCTTGG + Intronic
1165069195 19:33245986-33246008 AAGGAACCCCAGGGATTTCTTGG + Intergenic
1165403191 19:35614761-35614783 CAGGAGGCCTTGGGACTTCTAGG + Intronic
1166104234 19:40589586-40589608 GAGGAGACCCAGGGAGCTGTAGG + Intronic
1166540432 19:43601685-43601707 CAGGAAGCCCAGGGTGTACTTGG - Intronic
1167279153 19:48556430-48556452 GAGGAGGGGCAGGGAGTGCTGGG + Intronic
1167425199 19:49426604-49426626 AAGGAGTCCCAGGAAATTCTGGG - Exonic
1167480866 19:49730307-49730329 TGGGAGGCCAAGTGGGTTCTTGG - Intergenic
1167502279 19:49854965-49854987 CAGGGGGCCCAGGGTGGTCTGGG - Exonic
1167748104 19:51364600-51364622 GAAGAGGCCCAGGGAGCTGTAGG + Intronic
1168577946 19:57528572-57528594 TAGGAGGGCCATGGGGTTCCGGG + Intronic
924985436 2:265123-265145 TGGGAGGCCTAGGGTGTTCTAGG + Intronic
925503091 2:4528874-4528896 TAGGCGGGCCAGGCAGCTCTGGG - Intergenic
926013293 2:9425134-9425156 TGGGGGGCCCAGGATGTTCTAGG + Intronic
926125591 2:10269968-10269990 GAGGAGGCCCGGGGTGTTCTTGG + Intergenic
926932301 2:18052783-18052805 TGGGAGGCCCAGTGGGGTCTTGG - Intronic
927091796 2:19717960-19717982 TATGAGTCCCAGGGAATGCTGGG + Intergenic
927698523 2:25252798-25252820 TAGGAGGCCCAGGAAGCTGTAGG + Intronic
929409248 2:41678183-41678205 TAGGAGGCACAAGGACTTCCAGG + Intergenic
930032952 2:47069482-47069504 TTTGAGGCCCAGGGGGCTCTGGG + Intronic
931472911 2:62557345-62557367 TATGAGGCCCAGGAACATCTGGG + Intergenic
932891109 2:75598097-75598119 CACGAGTCCCAGGGAGTCCTAGG + Intergenic
942441591 2:176042572-176042594 TTGTAGGACCAGGGAGATCTTGG - Intergenic
944542634 2:200767942-200767964 TAGGGGGCCCTGGGAGACCTGGG - Intergenic
944556927 2:200896489-200896511 TAGGAGGCTTGGGGAGTACTTGG - Intronic
946170959 2:217895246-217895268 CAGGAGGTCCAGGGAGCTCATGG - Intronic
947591167 2:231386843-231386865 TGGGAGGCTCAGGAAGCTCTTGG + Intergenic
948451747 2:238079781-238079803 TAAGAGGCTCAGTGAATTCTGGG - Intronic
948515214 2:238499200-238499222 CTGGAGGCCCAGGCAGCTCTAGG + Intergenic
948830301 2:240595348-240595370 GTGGAGGCCCATGGAGGTCTGGG + Intronic
1172274470 20:33672325-33672347 CAGGAGGCCCAGGGAGAGTTGGG - Intronic
1172478955 20:35259775-35259797 TCGGAGGCCCAGGGACTTACAGG + Intronic
1173582229 20:44155360-44155382 TAAGTGGCCCAGGGTGTTCCAGG + Intronic
1173609958 20:44359790-44359812 TAGGAGAACAAGGTAGTTCTGGG + Intronic
1174747254 20:53075717-53075739 TAGGAGACTGAGGGAGTTCTTGG + Intronic
1174806012 20:53605055-53605077 TGGGAGCCACAAGGAGTTCTAGG + Intronic
1175294202 20:57897298-57897320 CAGGAGGCCCAGGGAGTGTTGGG + Intergenic
1175879667 20:62249980-62250002 CAGGAGGACCAGGGTGTGCTGGG - Intronic
1178295289 21:31404895-31404917 TAGGAGGAACAGGGAGCTGTTGG - Intronic
1179380061 21:40890170-40890192 CTGGAGGCCCAGGGAGGTCTAGG + Intergenic
1180016685 21:45090840-45090862 GAGGTGGCCAAGGCAGTTCTTGG - Intronic
1182097305 22:27634711-27634733 CAGGTGGCACAGGGAGTTGTAGG + Intergenic
1182293320 22:29298736-29298758 CAGGAGGCCCAGGAGGTCCTGGG + Exonic
1182846734 22:33437598-33437620 GTGTAGGACCAGGGAGTTCTGGG - Intronic
1183232817 22:36593465-36593487 GATGAGGCCCAGGGAGGCCTGGG + Intronic
1183259077 22:36782603-36782625 AAGGAGGGCCAAGGAATTCTGGG + Intergenic
1183360506 22:37380691-37380713 TAGGAGGACCAAGGACTCCTGGG + Intronic
1184038098 22:41928038-41928060 CAGGAAGTCCAGGGAGTGCTGGG + Intergenic
1184658128 22:45952382-45952404 TGGGAGACCCAGGGAGGTCTTGG - Intronic
1184981822 22:48100655-48100677 CAGGAGTCCCAGGGAGATCCAGG - Intergenic
949426333 3:3920772-3920794 TAGGAAGCTCAGGGACCTCTGGG - Intronic
950183612 3:10931886-10931908 GAGGAGGCCCAGGGCACTCTGGG + Intronic
952472086 3:33665974-33665996 TAGGAGGCCCACAAAGCTCTAGG + Intronic
952783231 3:37125399-37125421 TGGGAGGCCCAGGAAGGTGTGGG + Intronic
953227027 3:41030350-41030372 TAGGAGGCGCTGGGAGTGCCAGG - Intergenic
954502270 3:51029694-51029716 TTGGATCCCCAGGGAGTTGTGGG - Intronic
955125004 3:56102287-56102309 GAGGAAGCCCAGGCAGTGCTAGG + Intronic
956491923 3:69781730-69781752 TAGGAGGTACAGGGACTGCTTGG - Intronic
956794300 3:72704085-72704107 TGGGTGGCCCAGGGAGTTCACGG + Intergenic
958925445 3:100152048-100152070 TAGGAGGCACATGGAGTCATTGG + Intronic
960671635 3:120160098-120160120 GAGGAGGACCAGGTAGCTCTAGG + Intergenic
961643276 3:128378629-128378651 TAGGAGCCCCTGAGAGTTCATGG + Intronic
963960481 3:151304071-151304093 TGGGGGGCCCAGGGTGTTTTGGG + Intronic
964573746 3:158141427-158141449 CAGGAGGTCCATGGAGTTTTAGG - Intronic
966822144 3:183933454-183933476 CAGGAAGCACAGGGAGCTCTGGG + Intronic
966861208 3:184231670-184231692 TATGAGGCCCAGCGAGTGCCCGG + Intronic
967924015 3:194632743-194632765 TAGGAGGCCCAGAGAGGTTCTGG + Intronic
968704837 4:2073000-2073022 CAGGAGGACCATGGAGTCCTTGG - Exonic
968816847 4:2825976-2825998 CAGGAGGCCCAGGGAGGGCTGGG + Intronic
972046443 4:34670703-34670725 TTGGGGGCCCAGGGGGTACTGGG + Intergenic
975380511 4:73695309-73695331 GAAGAGGCCCAGAGAGTTTTTGG + Intergenic
979232346 4:118359722-118359744 TGGGAGGCCATGTGAGTTCTTGG - Intergenic
979935383 4:126687573-126687595 AATGAGTCCCCGGGAGTTCTAGG - Intergenic
980342767 4:131571895-131571917 TGGGAGGCCAAGGCAGGTCTCGG + Intergenic
983283689 4:165712427-165712449 CAGGAGGCCCAGGAACTCCTTGG - Intergenic
983906372 4:173186855-173186877 CAGGAGACCCAGGGAGTTGGAGG - Intronic
986483957 5:8217014-8217036 TTGGAGGGCCAGGGTGGTCTTGG - Intergenic
990249169 5:53895152-53895174 AGGGAGGCCCAAGGAGTGCTTGG + Intronic
991758672 5:69901505-69901527 CAGTAGGCCCAGGGAGTCTTGGG + Intergenic
991837901 5:70776571-70776593 CAGTAGGCCCAGGGAGTCTTGGG + Intergenic
997233219 5:132258251-132258273 TTGGTGACCCAGGGAGGTCTGGG + Intronic
998418126 5:141960124-141960146 TAGGAGCCCCTGGGAGCTCAGGG + Intronic
999262277 5:150245381-150245403 TTGGAGGCCCAGGGACTGCCTGG + Intronic
999390397 5:151185514-151185536 TGGGAGCCCCAGCCAGTTCTGGG - Exonic
999439894 5:151593090-151593112 TGAGAGGCCCAGGGAGTTGCAGG + Intergenic
1000742802 5:164990989-164991011 TTGGAAGCCCAGGTAGTTATGGG + Intergenic
1003299676 6:4866833-4866855 TACTAGGCCCAGAGAGTTCACGG + Intronic
1003889125 6:10548325-10548347 TGGGAGGCCCAGGAATATCTTGG - Intronic
1005494538 6:26376907-26376929 TAGGAGGCTCAGGAAGTTTCAGG - Exonic
1005503738 6:26452009-26452031 TAGGAGGCTCAGGAAGTTTCAGG - Exonic
1005932562 6:30494416-30494438 GAGAAAGCCCAGGGAGTCCTGGG + Intergenic
1006114332 6:31767228-31767250 GAGGAAGTCCAGGGAGGTCTGGG + Exonic
1006166726 6:32069755-32069777 GGAGAGGCCCACGGAGTTCTGGG + Intronic
1007700889 6:43766008-43766030 TAGGAGGTACAGGGACATCTAGG - Intergenic
1010194119 6:73223314-73223336 TAGGAGCCCCAGGGTTTTCCTGG - Intronic
1017233193 6:152094311-152094333 TAGGAGACCCAGAGTGTTCATGG - Intronic
1017597159 6:156041826-156041848 TAGGAGAACCAGTAAGTTCTAGG + Intergenic
1019547952 7:1587415-1587437 GTGGAGACTCAGGGAGTTCTGGG + Intergenic
1019770551 7:2881477-2881499 TATGGGACCCAGGGAATTCTGGG - Intergenic
1020213834 7:6173939-6173961 TGGGAGGCCCAGGGAGGTGTGGG - Intronic
1020421429 7:8010710-8010732 TAGTAGGCCTAGGGAGTTAGTGG - Intronic
1023177135 7:37446389-37446411 TAAGAGGCCCAGGGAGTGTCTGG + Intronic
1023333225 7:39141044-39141066 CAGGAGGCTCAGGGAGTGCTCGG - Intronic
1023865953 7:44238563-44238585 GGGGAGGCCCAGGGCGTCCTCGG - Intronic
1024181365 7:46898740-46898762 GAGAAGGCCCAGGGAGTCATGGG - Intergenic
1026851447 7:73726049-73726071 GAGGAGGCCCAGGGGCTGCTGGG + Intergenic
1027225539 7:76241356-76241378 GAAGAGGCCCAGGCAATTCTCGG + Intronic
1027347427 7:77275707-77275729 TAGGAGGCCCAGGAAAATCATGG - Intronic
1027491044 7:78826669-78826691 TAGGAGGTCAGGAGAGTTCTAGG + Intronic
1028241123 7:88421917-88421939 TAGGATGCCAAGGGAGCTCTTGG + Intergenic
1030066404 7:105662619-105662641 GAGGAGACCCAGGGAGCTCGGGG - Intronic
1034153035 7:148931794-148931816 TAGGAGGCCCAAGGTGTTTTAGG - Intergenic
1034412360 7:150948041-150948063 CAGGGGGTCCTGGGAGTTCTTGG - Intronic
1034590826 7:152137523-152137545 GGGGAGGCCCAGGAATTTCTAGG + Intronic
1035270202 7:157715264-157715286 AATGAGGCCCAGGGAGTGTTGGG + Intronic
1036498611 8:9293607-9293629 TAAGAAGCCCAGGGAGTTTTTGG + Intergenic
1038185730 8:25273115-25273137 TAGGAGGCCTAAGGAACTCTGGG - Intronic
1038330214 8:26602321-26602343 TAGGAGGACGAGAGAGATCTCGG - Intronic
1046306237 8:112371074-112371096 TAGGAGGCCAGGGGAAATCTGGG - Intronic
1047759816 8:127945913-127945935 AAGGAGGCCCAGAGAGCTCATGG - Intergenic
1047994773 8:130323956-130323978 TAGGAAGCCCTGGCAGCTCTGGG - Intronic
1048185754 8:132239083-132239105 TAAGGGGCCCAGGAATTTCTTGG - Intronic
1048277149 8:133075279-133075301 TCGTGGGCCCAGAGAGTTCTGGG - Intronic
1048883354 8:138888271-138888293 AAGGAAGCCCAGGGGGTTGTAGG + Intronic
1049316434 8:141971314-141971336 CATGAAGCCCAGGGAGTGCTTGG - Intergenic
1051551802 9:18338257-18338279 TAGGAGACCAAGGGAATTCCAGG - Intergenic
1053346583 9:37382835-37382857 CAGGAGGCCCTGGGAAATCTGGG - Intergenic
1053390400 9:37731042-37731064 CAGGAGGTCCAGGGGGTCCTTGG - Exonic
1059227493 9:112685747-112685769 AAGGAGGCCCAAGGAGTAGTTGG + Exonic
1060416893 9:123437077-123437099 TGGGGGGCCCTGGGAGTGCTTGG + Intronic
1062147618 9:134998704-134998726 TTGGTGACCCAGGGAGTGCTTGG + Intergenic
1186846404 X:13535121-13535143 CAGGTGGGCAAGGGAGTTCTAGG - Intergenic
1188092187 X:25977248-25977270 TCTAAGGCCCAGGGAGATCTGGG - Intergenic
1188894909 X:35654947-35654969 TTGGAGGCCCATGGAGTCCTTGG + Intergenic
1189309183 X:40008203-40008225 TAGGAGGCCCAGGGACTTTGCGG + Intergenic
1192151434 X:68715124-68715146 GAGGGTGCCCAGGGAGTTCAGGG - Intronic
1192314619 X:70042215-70042237 CAGAAGGCCCCAGGAGTTCTTGG + Exonic
1194705370 X:97169299-97169321 TAGGAGGCCCTAGGTGATCTGGG - Intronic
1196866212 X:120073478-120073500 TAGGGGGCCCAGGGAGTTTGTGG + Intronic
1196876885 X:120162803-120162825 TAGGGGGCCCAGGGAGTTTGTGG - Intronic
1198936313 X:141904785-141904807 GAGGAGGCCCAGGCAGTGCCAGG + Exonic
1198963262 X:142204369-142204391 GAGGAGGCCCAGGCAGTGCCAGG - Exonic
1202143049 Y:21748978-21749000 GAGGAGTCCCAGAGAGGTCTTGG - Intergenic
1202143778 Y:21756837-21756859 GAGGAGTCCCAGAGAGGTCTTGG + Intergenic