ID: 1138331995

View in Genome Browser
Species Human (GRCh38)
Location 16:56222723-56222745
Sequence GTCGCCCCTGGGTTTTTCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138331995_1138332002 24 Left 1138331995 16:56222723-56222745 CCGAGGAAAAACCCAGGGGCGAC 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1138332002 16:56222770-56222792 AGTCCTTTCCCTTGACACGTGGG 0: 1
1: 0
2: 2
3: 62
4: 602
1138331995_1138332001 23 Left 1138331995 16:56222723-56222745 CCGAGGAAAAACCCAGGGGCGAC 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1138332001 16:56222769-56222791 CAGTCCTTTCCCTTGACACGTGG 0: 1
1: 0
2: 2
3: 62
4: 951

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138331995 Original CRISPR GTCGCCCCTGGGTTTTTCCT CGG (reversed) Intronic
900279646 1:1858426-1858448 CTCATCCCTGGGTTCTTCCTGGG + Intronic
901296106 1:8161927-8161949 GTCTCCCCTGGGTTCTTTCCTGG + Intergenic
902212603 1:14914439-14914461 GTCGTGCCTGGGCCTTTCCTGGG - Intronic
902881122 1:19372409-19372431 GTCGGCCCCGGGTTCTGCCTGGG - Intronic
911256894 1:95643542-95643564 GTGGCTACTGGGGTTTTCCTAGG + Intergenic
912455485 1:109793848-109793870 TTTGCCCATGGGATTTTCCTGGG - Intergenic
920285065 1:204873392-204873414 GGCCTCCCTGGCTTTTTCCTAGG - Intronic
920915085 1:210252643-210252665 GTCCTCCCAGGGTTTTTCCAGGG - Intergenic
922240609 1:223753174-223753196 GTGGCTCTTGGGTTTGTCCTGGG - Intronic
1067142203 10:43667428-43667450 GTCGCCCCTGGGTTCCGCCGCGG - Intergenic
1072091096 10:92127911-92127933 GTGGCCCCTGGGTTCTTCAGGGG + Intronic
1074697013 10:116058818-116058840 GTCACCCCTGGGGTTTGTCTGGG + Intronic
1076486681 10:130824776-130824798 GCCTCCCCTGGCTTTGTCCTAGG - Intergenic
1079817351 11:25077878-25077900 GGTGCCCCTGGGCTTTTCCAAGG + Intronic
1080451205 11:32380317-32380339 GGAGCCTCTTGGTTTTTCCTGGG - Intergenic
1085394098 11:76197952-76197974 GTCGCTCCTGGGTCTCTGCTGGG - Intronic
1087431995 11:98066582-98066604 ATCACCCCAGGGGTTTTCCTTGG - Intergenic
1090969044 11:131623865-131623887 GCAGCCCCGAGGTTTTTCCTTGG - Intronic
1092831845 12:12452062-12452084 TTCCCCCCTGGATTTTACCTGGG + Intronic
1093369728 12:18352945-18352967 GTGGACCCTGGGGTTTTTCTGGG + Intronic
1093416534 12:18926991-18927013 GAGGACCCTGGGTGTTTCCTGGG - Intergenic
1102224441 12:111217933-111217955 GTGGGCCCTGGGTCTTACCTCGG - Exonic
1102292014 12:111708602-111708624 GGGGCCACTGGGTTTGTCCTTGG + Intronic
1106309209 13:28538857-28538879 CTTGCCCATGGGTCTTTCCTCGG - Intergenic
1111450514 13:88408981-88409003 GTCACTCCTGGGTTTTGCCATGG + Intergenic
1113765999 13:112881527-112881549 GGGGCCCCTGGGTTCTTCCCTGG + Intronic
1117989363 14:61418669-61418691 TTGGACCCTGGGTTTTGCCTTGG + Intronic
1117990802 14:61431281-61431303 CTCCTCCCTTGGTTTTTCCTTGG - Intronic
1119597109 14:75945028-75945050 TTCTCCCCTGGTTTTTCCCTTGG - Intronic
1124641269 15:31397995-31398017 GTCGACCCTGAGTTTATCTTGGG + Intronic
1128552423 15:68607021-68607043 GTCTCCCCTGGTTTTCTCCCTGG + Intronic
1129656613 15:77528990-77529012 GCAGCCCCTGGGCTGTTCCTGGG + Intergenic
1130996775 15:88908548-88908570 GTCACCCCTGCCTTCTTCCTGGG + Intronic
1133002452 16:2858184-2858206 GTCGCCCCAGGTTTTATCCTGGG + Intergenic
1135349715 16:21718392-21718414 GTGGCCCCAGAGATTTTCCTGGG - Intronic
1138331995 16:56222723-56222745 GTCGCCCCTGGGTTTTTCCTCGG - Intronic
1141631420 16:85290086-85290108 GTCGCCGCTTGGGTTTTCTTTGG + Intergenic
1146658707 17:34650396-34650418 CTTGCCCCTGGGTCTTTTCTGGG - Intergenic
1148210730 17:45806920-45806942 GTCACCCCTGCAGTTTTCCTGGG + Intronic
1151866207 17:76804956-76804978 GTGGGCCCTGGGTTTTGACTAGG + Intergenic
1153962534 18:10151810-10151832 GCCACTGCTGGGTTTTTCCTGGG - Intergenic
1156056673 18:33013753-33013775 GTCTTCCCTGGATTTTTCTTGGG - Intronic
1156730144 18:40183937-40183959 ATAGTCCCTGGGTTTGTCCTTGG + Intergenic
1159752881 18:72324691-72324713 GTCCTCCCAGGGTTTTTCTTTGG - Intergenic
1163531765 19:17854114-17854136 GTCCCCCCTGTCTTTTTCCCAGG - Intergenic
927514230 2:23662648-23662670 GATCCCCCTGGGTTTTGCCTTGG + Intronic
927520904 2:23697413-23697435 GTCTCCCCTGGGTTGTGCTTTGG - Intronic
927888140 2:26730915-26730937 GTCTCTGCTGGGTCTTTCCTAGG + Exonic
935122477 2:100195045-100195067 CTGGCCCCTGGGTGTTTACTGGG - Intergenic
937908069 2:127062005-127062027 GTCCCCCATGGGTTTGGCCTTGG - Intronic
937911929 2:127080041-127080063 CTCGCCCATGGGTCTTCCCTGGG - Intronic
941816826 2:169804165-169804187 GTCATACTTGGGTTTTTCCTTGG + Intronic
943479794 2:188404463-188404485 GTGAGCCCTGGGTTTTGCCTCGG + Intronic
1172764834 20:37345938-37345960 GCCGCCCCTGGGTCTCTCCCGGG + Intronic
1172793068 20:37519577-37519599 GTCTCCCCGGGGCTTCTCCTGGG + Intronic
1173199781 20:40945909-40945931 ATGGCCCTTGGGTTTTTCTTGGG - Intergenic
1175392416 20:58635753-58635775 GTCGGCCCTGCTTTTTTCCCAGG - Intergenic
950610763 3:14125248-14125270 GTCGCCCTGGGGCTTTTCCCCGG + Intronic
952876562 3:37949798-37949820 GGCCCACCTGGGTTTATCCTGGG - Intronic
954297040 3:49680030-49680052 GTCAACACTGGGCTTTTCCTGGG - Intronic
956250075 3:67226528-67226550 GTGGTCACTGGGTGTTTCCTCGG - Intergenic
962319958 3:134382131-134382153 CCCACCCCTGGGTTTATCCTTGG - Intergenic
962359525 3:134726209-134726231 TTCTCCCCTGGCTTTTTCCACGG + Intronic
963526702 3:146424220-146424242 GTCCTCCCTTGGTCTTTCCTTGG + Intronic
967754261 3:193150684-193150706 GGTGCCCCTGGATTGTTCCTGGG - Intergenic
977867748 4:102049993-102050015 CTCCTCCCTTGGTTTTTCCTTGG - Intronic
981661389 4:147171099-147171121 GTCTCCACTGAGGTTTTCCTGGG - Intergenic
985397635 4:189560879-189560901 GACTCCTCTAGGTTTTTCCTCGG - Intergenic
988536249 5:32071858-32071880 ATCCCCCCAGTGTTTTTCCTGGG + Intronic
991645210 5:68794644-68794666 GTTGCCCCTGTGGCTTTCCTTGG - Intergenic
995909661 5:117170377-117170399 TTTGCCCATGTGTTTTTCCTGGG + Intergenic
998471972 5:142390494-142390516 GCTGCCCCTGGGGTTTTACTGGG + Intergenic
1002983656 6:2166941-2166963 GTCTTCCCTGGGATTTTCCTTGG - Intronic
1003516148 6:6820806-6820828 GTCACCACTGGGCTTGTCCTGGG - Intergenic
1009642176 6:66351974-66351996 ATAGCCTTTGGGTTTTTCCTGGG + Intergenic
1023137448 7:37066443-37066465 GTGGCCACTGGGTTGTCCCTTGG + Intronic
1027357925 7:77377792-77377814 GTCAGGCCTGAGTTTTTCCTTGG - Intronic
1032561040 7:132893156-132893178 TTCGCCCCTGTGTTTTTGCAGGG - Intronic
1034400567 7:150858937-150858959 GTGGCCCCAGGGGTTCTCCTGGG - Exonic
1036776195 8:11614381-11614403 GTCGCTCCCGGGTTCTTCCCTGG - Intergenic
1040908316 8:52491729-52491751 GTAGAGCCTGGGTTTTTTCTGGG + Intergenic
1043549513 8:81354038-81354060 TTTGCTCCTGGGTTTTCCCTGGG + Intergenic
1044824450 8:96183038-96183060 CTCACCCCTTGGTTTTTGCTTGG + Intergenic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1055410410 9:76022947-76022969 CTCGCCCATGGGTTTTTCATAGG + Intronic
1056094560 9:83239364-83239386 TTCTCCCCTGGGTCTTCCCTTGG - Intergenic
1057045135 9:91879720-91879742 TTAGACCCTGGGCTTTTCCTGGG - Intronic
1061678143 9:132229748-132229770 GTGGCCCATGGGCTTCTCCTGGG - Intronic
1062233675 9:135497757-135497779 GACGACCCTGAGTTTTCCCTGGG - Intronic
1191675029 X:63784824-63784846 GTGACCCCTGGGATGTTCCTGGG + Intronic
1192016674 X:67338914-67338936 GTAGCTCCTGGGTTTTGCCATGG + Intergenic
1197708307 X:129649393-129649415 CTCGCCCCTGGGTGTCTCATCGG + Intronic
1200775543 Y:7167133-7167155 TTCGCCCCTGAGTCTTCCCTTGG + Intergenic