ID: 1138331995

View in Genome Browser
Species Human (GRCh38)
Location 16:56222723-56222745
Sequence GTCGCCCCTGGGTTTTTCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138331995_1138332001 23 Left 1138331995 16:56222723-56222745 CCGAGGAAAAACCCAGGGGCGAC 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1138332001 16:56222769-56222791 CAGTCCTTTCCCTTGACACGTGG 0: 1
1: 0
2: 2
3: 62
4: 951
1138331995_1138332002 24 Left 1138331995 16:56222723-56222745 CCGAGGAAAAACCCAGGGGCGAC 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1138332002 16:56222770-56222792 AGTCCTTTCCCTTGACACGTGGG 0: 1
1: 0
2: 2
3: 62
4: 602

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138331995 Original CRISPR GTCGCCCCTGGGTTTTTCCT CGG (reversed) Intronic