ID: 1138333048

View in Genome Browser
Species Human (GRCh38)
Location 16:56230639-56230661
Sequence ATAGCTAAGGGCCCCTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138333045_1138333048 -3 Left 1138333045 16:56230619-56230641 CCACAAGACTTTGATGTCACATA 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1138333048 16:56230639-56230661 ATAGCTAAGGGCCCCTTTTCTGG 0: 1
1: 0
2: 0
3: 2
4: 82
1138333043_1138333048 12 Left 1138333043 16:56230604-56230626 CCACTGAGACTCAGCCCACAAGA 0: 1
1: 0
2: 0
3: 18
4: 197
Right 1138333048 16:56230639-56230661 ATAGCTAAGGGCCCCTTTTCTGG 0: 1
1: 0
2: 0
3: 2
4: 82
1138333044_1138333048 -2 Left 1138333044 16:56230618-56230640 CCCACAAGACTTTGATGTCACAT 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1138333048 16:56230639-56230661 ATAGCTAAGGGCCCCTTTTCTGG 0: 1
1: 0
2: 0
3: 2
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138333048 Original CRISPR ATAGCTAAGGGCCCCTTTTC TGG Intronic
907295009 1:53445177-53445199 ATAGGGAAGGGCCCCCTGTCCGG + Intergenic
908680189 1:66652246-66652268 ATATTTAATGGCACCTTTTCTGG - Intronic
912796656 1:112697728-112697750 ATAATTAGGGGCCCATTTTCAGG - Intronic
913121491 1:115745247-115745269 AGGGCTCAGGGCCCCTTGTCAGG - Intronic
915119970 1:153623762-153623784 ATTGCCAAGGGTCCCTTTTGGGG + Intronic
923024106 1:230190655-230190677 ATAGAAAAAGGCCCCGTTTCAGG - Intronic
1065505366 10:26425223-26425245 CTAGCTCAAGACCCCTTTTCTGG + Intergenic
1073241014 10:102058206-102058228 ATAGGGAAGGGCCCCCTGTCCGG + Intergenic
1080650598 11:34219889-34219911 ATAGCAAAAGTCCTCTTTTCAGG - Intronic
1090881895 11:130840410-130840432 ATAGCTGAGGGAAGCTTTTCTGG + Intergenic
1093688608 12:22084487-22084509 ATTGTGAAGGCCCCCTTTTCTGG + Intronic
1099904740 12:88758851-88758873 AAACCTATGGGCCACTTTTCAGG - Intergenic
1104099008 12:125588692-125588714 TGAGCTAAGGGCACATTTTCGGG + Intronic
1110897214 13:80769438-80769460 ATAGTTGAGGGCCTCTTTTGTGG + Intergenic
1113878822 13:113611059-113611081 AAAGGTAAGGGCACCTGTTCTGG + Exonic
1117430472 14:55654451-55654473 AAAGCTTAGGGCCTCATTTCTGG + Intronic
1117604327 14:57411026-57411048 GTTGGTAAAGGCCCCTTTTCAGG + Exonic
1127795393 15:62433651-62433673 GTACATAAGGGCCCCTGTTCTGG + Intronic
1135175305 16:20222365-20222387 ACAGCTAAGGGCCACTTCCCAGG - Intergenic
1135720656 16:24814831-24814853 ATAGCTCAGGGGTTCTTTTCAGG - Intronic
1136671207 16:31859971-31859993 ATAGGGAAGGGCCCCCTGTCTGG + Intergenic
1137289764 16:47043997-47044019 TAAGCTCAGGGCTCCTTTTCAGG + Intergenic
1138333048 16:56230639-56230661 ATAGCTAAGGGCCCCTTTTCTGG + Intronic
1139401295 16:66683919-66683941 ATAGCTAAGCGGGCATTTTCAGG + Intronic
1148380175 17:47190749-47190771 ATAGCTAATGGCTACTTTCCAGG - Intergenic
1158220755 18:55148350-55148372 ATGTCTAATGGCCCATTTTCAGG + Intergenic
1162638522 19:11988671-11988693 ATAGGGAAGGGCCCCCTGTCTGG - Intergenic
1163688095 19:18723710-18723732 ATAGCTAAGGCTCCCTCTCCAGG - Intronic
1165618934 19:37227770-37227792 ATAGGGAAGGGCCCCCTGTCTGG - Intronic
1166554648 19:43690128-43690150 AGAGGTAAGGGCCCCTTCACAGG + Intergenic
1168658707 19:58149410-58149432 ATAGCTCGGGACCCCCTTTCTGG + Intronic
927702793 2:25278392-25278414 TGAGCATAGGGCCCCTTTTCAGG - Intronic
931040857 2:58298024-58298046 GCAGATAAAGGCCCCTTTTCTGG - Intergenic
940982383 2:160018128-160018150 ATATTTTATGGCCCCTTTTCTGG - Intronic
943797302 2:192012535-192012557 TTAGCTAGGGGCCCCTTCACAGG + Intronic
946948945 2:224851171-224851193 AAAGCTCAGGACCCCTCTTCTGG + Intronic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
1168857722 20:1020497-1020519 AGAGCTCTGTGCCCCTTTTCTGG - Intergenic
1169023993 20:2351885-2351907 ACAGCAGAGGCCCCCTTTTCTGG + Intergenic
1171566840 20:26202327-26202349 ATAGATTAGGGCCCAGTTTCTGG + Intergenic
1181928797 22:26382141-26382163 ATAGCTAAAGGCTGCTTTCCAGG + Intronic
1182574028 22:31260855-31260877 ATACTTAACAGCCCCTTTTCTGG - Intronic
1182753001 22:32656939-32656961 TTAGCTAAGGGCACCTTGTTGGG + Intronic
953171876 3:40514283-40514305 ATAGGGAAGGGCCCCCTGTCTGG + Intronic
958847974 3:99288384-99288406 ATAGCAAAGGCCTACTTTTCAGG + Intergenic
961844909 3:129754142-129754164 ATAGCTAAGTGCTCCTTTAATGG - Intronic
981004715 4:139862870-139862892 TTAGCTATGGGACCCTTCTCAGG + Intronic
986168207 5:5293890-5293912 ACAGCTGAGGGGCCCTTTCCTGG + Intronic
991274168 5:64824523-64824545 ATAACTAAGCTTCCCTTTTCAGG - Intronic
998316202 5:141184738-141184760 ATGCCTGAGGGCCCCTTTCCAGG + Exonic
998318064 5:141201953-141201975 GTGCCTAAGGGCCCCTTTCCAGG + Exonic
999120995 5:149209288-149209310 ATAGCTCTGGGCCCCTTACCTGG + Intronic
1001096262 5:168777885-168777907 ATAGCTAAGAGCTCCTTTCATGG - Intronic
1006176376 6:32124588-32124610 AAAGCTAAGAGCCCCTTAGCAGG + Intronic
1007568276 6:42870194-42870216 AGTGCTTAGGGCCCCTTTCCTGG - Intergenic
1009039977 6:58164512-58164534 ATAGCTAAGGAAACCTTTTTAGG + Intergenic
1009215871 6:60919361-60919383 ATAGCTAAGGAAACCTTTTTAGG + Intergenic
1012310609 6:97719868-97719890 ATAGCTAAGGGCAATTTTTAGGG - Intergenic
1016989076 6:149917045-149917067 ATAGCGAAGCGCCCCTTGTCTGG - Exonic
1017792807 6:157816162-157816184 ATAGCAAAGGGGCGGTTTTCAGG - Intronic
1020258544 7:6516842-6516864 ATAGGGAAGGGCCCCCTGTCTGG + Intronic
1020810634 7:12846331-12846353 GGAGCTAAGGGCCCCATTTGAGG + Intergenic
1029842378 7:103379431-103379453 GTTGCTAAGGTCCCCTTTTCAGG + Intronic
1032959844 7:137018936-137018958 ATTGCTAAGTGTCCCCTTTCGGG - Exonic
1037180834 8:16003778-16003800 AAAGGTAAGGGCCCCATGTCTGG - Intergenic
1041616605 8:59914938-59914960 ATAGCTCAGGGCCACATCTCTGG + Intergenic
1044923905 8:97193498-97193520 ATAGATTAGGGCCCTTCTTCTGG + Intergenic
1048611667 8:136029450-136029472 ATTGCTTATGGCACCTTTTCTGG - Intergenic
1048780158 8:137991003-137991025 AAAGCTCATGGCCGCTTTTCCGG - Intergenic
1049516461 8:143060529-143060551 ATAGGGAAGGGCCCCCTGTCTGG + Intergenic
1056172119 9:83996425-83996447 TTAGCTAAGTGCCCTTTTCCTGG + Intronic
1056508458 9:87280144-87280166 AAACCTCAGGGCCACTTTTCAGG + Intergenic
1057897988 9:98924864-98924886 AAAGCCAGGGGCCCATTTTCTGG - Intergenic
1061912578 9:133732823-133732845 ATAGCAAAGGCCCCCATTTTTGG + Intronic
1062557622 9:137122048-137122070 ATAGGGAAGGGCCCCCTGTCCGG + Intergenic
1062642302 9:137525500-137525522 ATAGGGAAGGGCCCCCTGTCCGG - Intronic
1187993375 X:24899660-24899682 CTAGCTAATGGCCCATTCTCAGG + Intronic
1188953261 X:36403204-36403226 ATAGCTGAGGGTACATTTTCTGG + Intergenic
1188955656 X:36432934-36432956 ATAGGGAAGGGCCCCCTGTCTGG - Intergenic
1192142838 X:68659973-68659995 ATAGGTTGGGGGCCCTTTTCGGG + Intronic
1193930029 X:87542240-87542262 ATAGAAAAGAACCCCTTTTCTGG + Intronic
1196122622 X:112067081-112067103 ATACCTAAGGCCCACTTATCAGG - Intronic
1196535468 X:116838507-116838529 AAATCTAAGGCCCCATTTTCAGG - Intergenic
1198550655 X:137742025-137742047 AGAGCTAAGGACCCATTCTCTGG - Intergenic
1199430232 X:147751190-147751212 ACACCTAAAGGCTCCTTTTCTGG - Intergenic