ID: 1138334882

View in Genome Browser
Species Human (GRCh38)
Location 16:56245243-56245265
Sequence GCTCACCAGATTTCTAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138334882_1138334887 25 Left 1138334882 16:56245243-56245265 CCATTCTTAGAAATCTGGTGAGC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1138334887 16:56245291-56245313 AAATTCAGTTTGTATGGATTTGG 0: 1
1: 0
2: 2
3: 27
4: 331
1138334882_1138334886 19 Left 1138334882 16:56245243-56245265 CCATTCTTAGAAATCTGGTGAGC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1138334886 16:56245285-56245307 ACTGCTAAATTCAGTTTGTATGG 0: 1
1: 0
2: 1
3: 21
4: 187
1138334882_1138334888 30 Left 1138334882 16:56245243-56245265 CCATTCTTAGAAATCTGGTGAGC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1138334888 16:56245296-56245318 CAGTTTGTATGGATTTGGCTTGG 0: 1
1: 0
2: 1
3: 16
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138334882 Original CRISPR GCTCACCAGATTTCTAAGAA TGG (reversed) Intronic
901123960 1:6916287-6916309 GCTCATCCGTTTTCCAAGAAAGG + Intronic
903369669 1:22827084-22827106 GAGCACAAGATTTCTATGAAAGG + Intronic
903471899 1:23593146-23593168 GCTTCCCAGAGTTGTAAGAAGGG + Intronic
904228417 1:29044908-29044930 GGTCACCTGATTTATAACAAAGG - Intronic
905584042 1:39103842-39103864 GCTCACCTGATTTCTGATCAGGG + Intronic
908754714 1:67458700-67458722 AGTCACCAGATTTCTTGGAAGGG - Intergenic
917872498 1:179254613-179254635 GTTCCCCAGATCTCTAATAATGG + Intergenic
921650102 1:217667504-217667526 AATGACCAGTTTTCTAAGAATGG + Intronic
1064613085 10:17124199-17124221 GCTGGCCACATTTCTAACAAAGG - Intronic
1064750805 10:18526536-18526558 GCTCACAATATTTCTAAAGAAGG - Intronic
1066212252 10:33251808-33251830 GCTCCCCACATTACCAAGAATGG + Intronic
1068647391 10:59482596-59482618 TTTAACCAGATTTCAAAGAATGG - Intergenic
1068966952 10:62922151-62922173 GCTCCCCAGATTCCTTAGATAGG - Intergenic
1071674486 10:87642327-87642349 TCTCAGCAGAATTCTAAGAAAGG + Intergenic
1073378235 10:103055554-103055576 GCTCACTTGATTGCTCAGAATGG + Intronic
1073605707 10:104893801-104893823 GCTGACCAGACTACTAAGCATGG - Intronic
1074822763 10:117193765-117193787 GTTCAACAGATTTTTCAGAAAGG + Intergenic
1075430520 10:122375649-122375671 CCTCACCAGAATTCTACCAAAGG - Intronic
1076388725 10:130079615-130079637 GTTAACTAGATTTCTCAGAATGG - Intergenic
1077385543 11:2267942-2267964 GCTCACCTGAATTCTAAGAGCGG - Intergenic
1078364713 11:10697011-10697033 GCTGACCACAGTTCTAAAAAAGG + Intergenic
1078960580 11:16263502-16263524 GCTCATCAGATATGGAAGAAAGG + Intronic
1079308037 11:19341808-19341830 GCTTACCAGAATTCTAAGACTGG + Intergenic
1081746766 11:45478624-45478646 GCTCACAACATTCCTGAGAAAGG - Intergenic
1082694067 11:56338000-56338022 GCCCACTAGATTTCCAGGAATGG + Intergenic
1089760085 11:120716823-120716845 GCTCATCAGAGTGCTAAGGATGG + Intronic
1090437703 11:126700633-126700655 ACTCCCCAGCCTTCTAAGAATGG - Intronic
1090956818 11:131520567-131520589 GCTCCCCAAGTTTCTAAGAAAGG - Intronic
1092565327 12:9659295-9659317 GCTGGTCAGATTTTTAAGAAGGG - Intergenic
1094130593 12:27070674-27070696 CCTCAACAGTTTTTTAAGAAGGG + Intergenic
1095812769 12:46388002-46388024 GCTCACAACACTTCTAAGCATGG + Intergenic
1096862251 12:54538286-54538308 TCACACCAGATCTCTGAGAAGGG + Intronic
1097904623 12:64906988-64907010 GATCAAATGATTTCTAAGAAAGG + Intergenic
1098210267 12:68156451-68156473 ACTCACCACATTTCTGAGGATGG + Intronic
1098942427 12:76552823-76552845 CCTCTCCAGATTTCTAAAATAGG + Intronic
1100621247 12:96276188-96276210 GGTCAACTGATTTCTGAGAAGGG + Intergenic
1100878097 12:98984499-98984521 GCTAAGGAGATTTCCAAGAAAGG - Intronic
1101228398 12:102713190-102713212 CCTCACCAAAATTCTAATAATGG - Intergenic
1103408054 12:120689540-120689562 GCTTACCAGGTTCCTGAGAAAGG + Intronic
1104048296 12:125179040-125179062 GATCTCCAGATTTTTAACAAGGG + Intergenic
1104232072 12:126895249-126895271 GCTCTCCTGATTTCTCAGATTGG + Intergenic
1107961779 13:45565384-45565406 GCTCTCCAGGTTTCTGAGAGTGG + Intronic
1108670496 13:52682640-52682662 GCTCAACTGATTTTTAAGAAAGG - Intronic
1109129713 13:58567680-58567702 GCTCAACAGATTTTTAATAAAGG - Intergenic
1110632914 13:77730314-77730336 GTTCACCAGATTTCCAAAAAAGG - Intronic
1111118871 13:83820333-83820355 TCTTACCAGATTTTTAAGCATGG + Intergenic
1111423252 13:88045852-88045874 GCTCACCAGATGTGTAGAAAGGG - Intergenic
1116871604 14:50073788-50073810 GGTATCCATATTTCTAAGAAAGG - Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1125886507 15:43233732-43233754 ACTCACCAGATATTTACGAAGGG + Intronic
1127521703 15:59749468-59749490 GCTCCCCTGATTGCTAGGAAAGG + Intergenic
1127611583 15:60642451-60642473 GCTCATTATATTTCTAAGCAGGG - Intronic
1127623999 15:60762464-60762486 GGTCACCAGAATTCAGAGAAAGG + Intronic
1128785312 15:70392342-70392364 GCTTGCCAGATTTAAAAGAAAGG + Intergenic
1133638573 16:7695014-7695036 ACACACAATATTTCTAAGAAAGG + Intronic
1138334882 16:56245243-56245265 GCTCACCAGATTTCTAAGAATGG - Intronic
1139100862 16:63764999-63765021 GTTTACTAGACTTCTAAGAAAGG - Intergenic
1139649548 16:68355492-68355514 GCTCTCCGGATTTTTAAGATGGG - Intronic
1140443803 16:75007585-75007607 GCTCTCCTGATTTCTGTGAATGG + Intronic
1141873449 16:86805531-86805553 TATCACCACATTTTTAAGAAGGG - Intergenic
1146574555 17:33979659-33979681 GCTCTGCAGAATGCTAAGAAGGG - Intronic
1146828848 17:36048654-36048676 TCTCACTAGCTTTCTAACAATGG + Intergenic
1151062523 17:71112628-71112650 GGTCCCAAGATTTCTAATAATGG + Intergenic
1152166320 17:78709885-78709907 TCTTATCAGATTTCTAAGAAAGG + Intronic
1156650401 18:39219158-39219180 TCTCACCATATTTCTAGTAAGGG + Intergenic
1158564837 18:58545889-58545911 GCTCAGCAGATATTTAGGAAAGG - Intronic
1162219283 19:9162357-9162379 GCTCACAAGATTCATAAAAATGG - Exonic
1163904529 19:20140012-20140034 GATCATCAGATTTCTATCAAAGG + Intergenic
1166623032 19:44321661-44321683 CCACAACAGACTTCTAAGAAAGG - Intergenic
1167207311 19:48111339-48111361 GCTCACAGGTTTTCTAAAAATGG - Intergenic
1167790141 19:51671202-51671224 ACTCATCAGATTGCTAAAAATGG - Intergenic
926442478 2:12904307-12904329 TTTCACCAGTTTTATAAGAACGG + Intergenic
926641417 2:15241810-15241832 GCTCCCCAAATTTCTCAGCACGG + Intronic
926923050 2:17958336-17958358 CCTCACAATAGTTCTAAGAAAGG - Intronic
931436192 2:62249154-62249176 GCAAACCATATTTCTAAAAAAGG + Intergenic
931907704 2:66860378-66860400 GGGCACCAGATTGCCAAGAAAGG + Intergenic
932294504 2:70613135-70613157 GATCAGCAAATTTCTAAGGATGG + Intronic
932900269 2:75690346-75690368 GCTAACCAGATTCCGAAGAGGGG + Intronic
933328192 2:80864582-80864604 AATCACTAGATTTCTAAAAATGG + Intergenic
938220083 2:129558808-129558830 GGGCATCAGATTTCTAAGGATGG + Intergenic
940035069 2:149304217-149304239 CCTGACCAGATTTTTCAGAAGGG + Intergenic
942325885 2:174776921-174776943 GCTCCTCATGTTTCTAAGAAAGG - Intergenic
943416138 2:187607011-187607033 AAGCACCAGTTTTCTAAGAAAGG + Intergenic
944354815 2:198774641-198774663 GCTCACCTGATTGCTAATTAGGG + Intergenic
947730342 2:232425235-232425257 GCTCTCGAGATTAATAAGAAAGG + Intergenic
1169951015 20:11043200-11043222 GCTGACCAGATTTGTTATAAAGG + Intergenic
1170474186 20:16698612-16698634 GCTCACAAGATTCCTAAAAAAGG - Intergenic
1173157948 20:40630981-40631003 CCTCACCAGAACCCTAAGAAGGG + Intergenic
1175649908 20:60711193-60711215 GCCCAGCAGAGTTCAAAGAAAGG - Intergenic
1177071375 21:16512947-16512969 GATCACTAGATTTTTAAGAGGGG - Intergenic
1177101239 21:16898877-16898899 GATCACCAGGTGTCTAGGAAGGG - Intergenic
1177738801 21:25127559-25127581 GGTCACCAGATTTTTTGGAATGG + Intergenic
1179573931 21:42295017-42295039 TCCCACCAGATTTCTTATAAAGG - Intronic
1181328833 22:22073718-22073740 GCTCCCCAGATGTCAAAGCAGGG + Intergenic
954352018 3:50052520-50052542 GGTCAACTGATTTCTAACAATGG - Intronic
955757251 3:62237887-62237909 CTTCAAAAGATTTCTAAGAAAGG - Intronic
957709735 3:83840039-83840061 GCTAAGCAAATCTCTAAGAATGG - Intergenic
958159904 3:89805421-89805443 ACTCACCAGATTTTTATGAGTGG + Intergenic
958773771 3:98457198-98457220 GCTTGCCAGCTTTCTAAGTAGGG + Intergenic
963262759 3:143209463-143209485 TCTTATCAGATTTCTCAGAAGGG + Intergenic
964460577 3:156921593-156921615 CAACACCAGATTTCTAGGAAAGG - Intronic
964579429 3:158216066-158216088 GCTCACTGAATTTCTAATAAAGG - Intronic
964815272 3:160710679-160710701 GGTCAACAGATTTCTAAGCCAGG + Intergenic
965365500 3:167794068-167794090 ATTCACCTGATTTTTAAGAAGGG - Intronic
966411076 3:179646569-179646591 GCTCACAAGATGTGTAAGAGTGG + Intergenic
966579588 3:181545527-181545549 GCTGCCCAGATTTCTCATAAAGG + Intergenic
968119598 3:196115921-196115943 GCTCACCACACTCATAAGAAAGG + Intergenic
970715022 4:18911852-18911874 GGTCAACAAATTTCTAGGAAAGG + Intergenic
971403568 4:26299470-26299492 GTTCACAAAATTTCTCAGAATGG - Intronic
971761257 4:30768782-30768804 GCTGAACACAATTCTAAGAAAGG - Intronic
972594873 4:40520744-40520766 CCTCAACAGATGTGTAAGAAAGG + Intronic
973148597 4:46860550-46860572 ATTCACCAGATGTCAAAGAAGGG - Intronic
975442445 4:74427143-74427165 TCTGAACACATTTCTAAGAAGGG - Intergenic
976425579 4:84899328-84899350 GCTCACCTAATTTATAAGACAGG - Intronic
976848912 4:89522383-89522405 GCTGAACAGATGTTTAAGAATGG + Intergenic
977716732 4:100191013-100191035 GCTCGCCAGCATTTTAAGAAGGG + Intergenic
978245772 4:106570899-106570921 GTTCACAGGTTTTCTAAGAATGG - Intergenic
981232142 4:142369236-142369258 CCTCACCTCATTTCTAAGAGAGG + Intronic
981817008 4:148842455-148842477 TCTCAGCAGCCTTCTAAGAAGGG - Intergenic
982084735 4:151822625-151822647 GCTTACAAAATTTCTGAGAAGGG - Intergenic
982744088 4:159088249-159088271 GGTCAACTGATTTCTTAGAAAGG - Intergenic
986940599 5:12944629-12944651 CCTGACCAGATTTCTAAACAAGG + Intergenic
987528514 5:19083558-19083580 GCTCACTAGATTTTTTAAAATGG + Intergenic
990031371 5:51263419-51263441 GCTTACCATATATCTAATAAGGG - Intergenic
990216488 5:53537917-53537939 GCTCACCAAATCTCTAATCAGGG + Intergenic
990531396 5:56676897-56676919 ACTGACCAGAAATCTAAGAAAGG + Intergenic
990693883 5:58393355-58393377 GCTTACCTGAGTTCTGAGAAGGG + Intergenic
992848831 5:80783348-80783370 GCTTACCATTTTTCTAAGTATGG + Intronic
994549077 5:101208068-101208090 GTTCCCCAGATCTCTAGGAAAGG - Intergenic
996560919 5:124828382-124828404 GCTCACCAAAATCCTAAAAATGG - Intergenic
998348800 5:141487372-141487394 TCTCACCAGATCTCGAAGGAGGG + Exonic
998818291 5:146035315-146035337 GCTCACTAAATTCCTTAGAAGGG + Intronic
999272431 5:150304398-150304420 GGTGACCAGATTTATCAGAAGGG + Intronic
1000310973 5:160044454-160044476 ACTCATGAGATTTCCAAGAATGG + Intronic
1000448273 5:161351790-161351812 GCACACCATACTTCTAATAAGGG + Intronic
1000793680 5:165638197-165638219 CCTCACTATATTTCTTAGAAGGG - Intergenic
1001530589 5:172458729-172458751 ATTCACGAGTTTTCTAAGAAAGG - Intergenic
1004696790 6:18041705-18041727 GCTCCCCAGGTATCAAAGAAGGG + Intergenic
1007914834 6:45551762-45551784 GCTCACCACAATTCTAAAATAGG + Intronic
1009588154 6:65633236-65633258 TCTCACCACTTTTCTAAGCAGGG + Intronic
1011121536 6:83959010-83959032 ATTCACCAGTTTTCAAAGAAAGG - Intronic
1011618185 6:89217204-89217226 GTCCACGAGATGTCTAAGAAAGG - Exonic
1011850232 6:91618147-91618169 CCTATTCAGATTTCTAAGAATGG - Intergenic
1013040890 6:106432419-106432441 CCTCAACAGATGTCTGAGAAGGG - Intergenic
1014697819 6:124645711-124645733 GATCACCAGACTTTTAAGGAAGG + Intronic
1016596374 6:145806261-145806283 GCTCATCAGCTTTACAAGAATGG + Exonic
1018029916 6:159833727-159833749 GCTCACCAGATTTCTACCATGGG + Intergenic
1024195134 7:47052020-47052042 GCTCAACAGATTTTTGACAAAGG - Intergenic
1026996308 7:74619170-74619192 TCTAATCAGATTTCTCAGAAAGG + Intergenic
1028438679 7:90833784-90833806 GCTGGCAAGATTTTTAAGAAAGG + Intronic
1029453370 7:100655245-100655267 GCCCACCAGGTTTCTGGGAAGGG - Intronic
1029523699 7:101081406-101081428 TCTCAGCATATTTCTTAGAATGG - Intergenic
1030136219 7:106252950-106252972 GCTCACCAAATTAATAAGAAAGG - Intronic
1033442880 7:141396096-141396118 GCTCACCAGCTCTCTCAGAGAGG + Intronic
1039048968 8:33475629-33475651 CCTCAACAAATTTCAAAGAATGG + Intronic
1039248075 8:35631485-35631507 GGTCAACAGCTTTCTAACAAAGG - Intronic
1041828064 8:62120858-62120880 GATCACCAGATTTTTTAAAAAGG + Intergenic
1043287694 8:78554683-78554705 TTTCACCAGCTTTCTAAGAAAGG + Intronic
1044792343 8:95860813-95860835 GCTCATCATCTTTCTAAGATTGG + Intergenic
1050774306 9:9240831-9240853 GCTCATCAGGTTTCTAATCACGG + Intronic
1051698851 9:19797406-19797428 GATCACCAGATATTTTAGAAAGG - Intergenic
1051735399 9:20192826-20192848 GCTCTTGAGTTTTCTAAGAAAGG - Intergenic
1051985476 9:23081333-23081355 GCTGACAGCATTTCTAAGAACGG - Intergenic
1054699180 9:68395261-68395283 GGTCAACAGATTTTTAATAATGG - Intronic
1054927975 9:70607244-70607266 TCTCACCAGATTTTCAAAAATGG - Intronic
1055554566 9:77461552-77461574 GCTCACCATCTTTATCAGAAGGG + Intronic
1188555281 X:31405068-31405090 ACTCTCCGGATTTCTAAGCATGG - Intronic
1188931960 X:36123222-36123244 GCTCACCACAGTCCTAAGACTGG - Intronic
1189995487 X:46633281-46633303 GAACAGGAGATTTCTAAGAAAGG + Intronic
1190191914 X:48283902-48283924 GCAAACCACATATCTAAGAAAGG - Intergenic
1190422969 X:50304110-50304132 GGTCAACTGATTTCCAAGAAGGG - Intronic
1192551884 X:72061081-72061103 GTTCACCAGAGCTCTAAGTAAGG - Intergenic
1195142564 X:101977615-101977637 CCACACTAGATTTCTAAGAATGG - Intergenic
1199271837 X:145892956-145892978 GCTCAAAGGATTTCTAAAAATGG - Intergenic
1200944917 Y:8825197-8825219 GTTCCCCAAATTTCTAAGGAAGG + Intergenic