ID: 1138339882

View in Genome Browser
Species Human (GRCh38)
Location 16:56281626-56281648
Sequence CATAATAATGAGCTGGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138339882 Original CRISPR CATAATAATGAGCTGGAGTG AGG (reversed) Intronic
902063691 1:13666301-13666323 CATAATGAAGAGCAGGAATGGGG + Intergenic
904319973 1:29690247-29690269 GAGAATTAAGAGCTGGAGTGAGG - Intergenic
905074378 1:35256849-35256871 TATAAAAATTAGCTGGTGTGAGG - Intergenic
905208914 1:36359823-36359845 CAACATTAGGAGCTGGAGTGTGG - Intronic
907653149 1:56315816-56315838 AATAATAATAAGCAGGAATGAGG + Intergenic
909069256 1:70974701-70974723 AAAAATAATCAGCTGGAGGGTGG - Intronic
909466404 1:75978681-75978703 CATAATAATGAACTGAATTCTGG - Intergenic
910542002 1:88370162-88370184 GATACTGAAGAGCTGGAGTGGGG - Intergenic
910722887 1:90306891-90306913 CTTAATAGAGAGCTGGAGTATGG + Intergenic
912053982 1:105571150-105571172 CATATTAATTAGCTCGATTGTGG + Intergenic
912437024 1:109668914-109668936 CATAATCAGGAGCTGTGGTGGGG - Exonic
912439721 1:109688662-109688684 CATAATCAGGAGCTGTGGTGGGG - Exonic
918598972 1:186330474-186330496 CATGAAAATGAGCTGGAATTTGG - Intronic
920645221 1:207798279-207798301 TATAATAATATGCTGCAGTGTGG + Intergenic
923144486 1:231188349-231188371 AATCCTAATGAGCTGGAGAGTGG + Intronic
923811777 1:237325978-237326000 CATAATAATGAGAAGGATGGTGG + Intronic
924103493 1:240627814-240627836 CATGAAAATGTGCTGGAGTTTGG - Intergenic
1063359569 10:5440467-5440489 TACAATAATGAGGTGGACTGTGG - Intronic
1063978502 10:11435699-11435721 CATAATAAAAGGCTGGGGTGGGG - Intergenic
1066496070 10:35943510-35943532 AATAACAATGAGTTGCAGTGTGG - Intergenic
1066624461 10:37392166-37392188 AATAATAATTATTTGGAGTGGGG - Intergenic
1069308138 10:66998049-66998071 TAGAAGAATGAGCTGGAATGGGG - Intronic
1070572928 10:77654995-77655017 CTCAGTAATGAGCTGGAGAGTGG - Intergenic
1072073397 10:91943407-91943429 CAAGATAATGGCCTGGAGTGGGG + Intronic
1073110323 10:101059507-101059529 CAGAATGATGAGCTGGAGTGTGG - Intergenic
1076038344 10:127220662-127220684 CATATTACTGAACTGGACTGGGG - Intronic
1076398396 10:130158609-130158631 GAAAATAATGAGCTGGAGGATGG + Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1080226896 11:29972188-29972210 CATGTTAATGAGCAGGAGAGAGG - Intergenic
1080934951 11:36853315-36853337 GTTAATACTGAGCTGGAGAGTGG + Intergenic
1082735474 11:56850957-56850979 TATAAGAAAGAGATGGAGTGGGG + Intergenic
1085964622 11:81507021-81507043 CATAAAAATGACCTGAAGTGAGG - Intergenic
1086357457 11:86018586-86018608 CATAAGAATGAGATGGATTGAGG + Intronic
1090330494 11:125927624-125927646 CACACTAAGGAGCTGGAGTGAGG - Intergenic
1090362253 11:126181941-126181963 CCTCAGAATGAGCTGGAGTTGGG + Intergenic
1090451753 11:126812298-126812320 GATAATAATGAGAAGGACTGGGG + Intronic
1092570072 12:9711622-9711644 AATAATAATAATCTGGGGTGGGG - Intergenic
1098752799 12:74317227-74317249 CATGATAAGCAGCTGGTGTGAGG - Intergenic
1102688303 12:114741186-114741208 AATAATAATGAGGTGGAGGAAGG - Intergenic
1103072711 12:117957983-117958005 CAAAAAAATTAGCTGGTGTGGGG - Intronic
1104546156 12:129714615-129714637 CATAATAATCAGCTTGATTTTGG + Intronic
1105824436 13:24109489-24109511 CATTAAAGAGAGCTGGAGTGTGG - Intronic
1109666424 13:65544857-65544879 CATAATATTGAGCTAGAAAGAGG + Intergenic
1110268930 13:73571298-73571320 AAAAATAATGAACTGGAGAGGGG + Intergenic
1112999721 13:105620057-105620079 CATAGTAATGAGAAGGACTGGGG + Intergenic
1115097239 14:29651609-29651631 AATAATAATGAGAAGGAGAGAGG - Intronic
1116141195 14:40996237-40996259 CATAAAAATTAGATGAAGTGTGG - Intergenic
1117198064 14:53361042-53361064 CATAATTATAAGCTGGGGTGGGG + Intergenic
1117442067 14:55769386-55769408 CATGAGCATGAGGTGGAGTGTGG + Intergenic
1118596248 14:67437713-67437735 CTTACTGATGGGCTGGAGTGAGG + Intergenic
1122077121 14:99243188-99243210 AATAACAAGGAGCTGGGGTGGGG + Intronic
1126226070 15:46271396-46271418 CATCATAATGAGGCAGAGTGTGG - Intergenic
1126453898 15:48840642-48840664 AGTAATAAAGAGATGGAGTGGGG - Intronic
1128755411 15:70180462-70180484 AATAATAAGGAGCTGGTGTGAGG + Intergenic
1129017676 15:72482994-72483016 CAAAAAAATAAGCTGGGGTGTGG - Intronic
1130066640 15:80610326-80610348 TATAAAAATTAGCTGGGGTGTGG - Intergenic
1130354983 15:83120859-83120881 GATAAGAATGAGCTGGAGCCGGG - Intronic
1130430871 15:83845783-83845805 CACAAGAATGAGTTGGTGTGAGG + Intronic
1130690718 15:86079551-86079573 CAAAATAAAGAGGTGGGGTGGGG + Intergenic
1134756667 16:16673316-16673338 CACATCAAGGAGCTGGAGTGAGG - Intergenic
1134853303 16:17499553-17499575 GACAGTAATAAGCTGGAGTGGGG - Intergenic
1134989401 16:18685847-18685869 CACATCAAGGAGCTGGAGTGAGG + Intergenic
1135113819 16:19709788-19709810 CAGAACAGTGAGCTGGAGAGGGG - Intronic
1137010104 16:35312993-35313015 CATAATAAAAGGTTGGAGTGTGG + Intergenic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1138339882 16:56281626-56281648 CATAATAATGAGCTGGAGTGAGG - Intronic
1141490312 16:84368294-84368316 CCTAAGAATCACCTGGAGTGGGG - Intergenic
1143349705 17:6278260-6278282 CATAAAAATAAGCTGGAGGCCGG - Intergenic
1148996957 17:51719023-51719045 GGGAATAAAGAGCTGGAGTGAGG - Intronic
1150093607 17:62352410-62352432 CAAAATAATGAACTAGAGAGTGG + Intergenic
1160724493 19:611713-611735 CATGAGAATGTTCTGGAGTGAGG - Intronic
1161829387 19:6591353-6591375 CAGAAGAATGAGGTGGAGAGGGG - Intronic
1162055006 19:8057313-8057335 AATAATAATGAGCTGGAGCCAGG - Intronic
1165499413 19:36176038-36176060 CATAATAATGAGTTGAGGTCAGG - Intergenic
1165749007 19:38248668-38248690 TATAATCAGGAGCTGGGGTGGGG - Intronic
1165895753 19:39139852-39139874 CATGCTTCTGAGCTGGAGTGAGG + Intronic
925006045 2:443766-443788 CATAATACTGAAATGGATTGAGG + Intergenic
926058466 2:9790447-9790469 CACAAAAATTAGCTGGGGTGTGG - Intergenic
926471574 2:13266219-13266241 CATTAAAATGAGCTAGAGTTTGG - Intergenic
928125848 2:28615229-28615251 CATGAGAATGAGGTGGAGAGTGG + Intronic
929394996 2:41512647-41512669 CATGATAATGAGCTAGAGAGAGG - Intergenic
933148848 2:78890258-78890280 GATAATAAAGACCTGGAGTGTGG - Intergenic
933727491 2:85435032-85435054 CAGATTATTGAGCTGGGGTGGGG - Exonic
938687609 2:133755705-133755727 CATAATCACGAGCTGCTGTGTGG - Intergenic
939477704 2:142707617-142707639 CATAATAAAAAGCTAGGGTGGGG - Intergenic
940001710 2:148973208-148973230 CACAATAAAGGGCTGTAGTGTGG - Intronic
941280231 2:163540726-163540748 CAAAACAATTAGCTGGAGTGTGG + Intergenic
941415998 2:165222440-165222462 CATAATAATGTGATGGGTTGAGG - Intergenic
945023359 2:205596413-205596435 CCAAATAATGAGCTGGATTCTGG + Intronic
945925263 2:215796888-215796910 CCTCAAATTGAGCTGGAGTGGGG - Intergenic
946218750 2:218207901-218207923 CAAAAAAATTAGCTGGGGTGTGG + Intergenic
947104589 2:226655354-226655376 CAGAAGCATGAGCTGGAATGTGG - Intergenic
1169204951 20:3734167-3734189 CAAAAAAAGGAGCGGGAGTGGGG + Intronic
1170149266 20:13212012-13212034 CATACTAATGAAATGGAGTGGGG + Intergenic
1172300382 20:33845641-33845663 CTTAATGATGGGCTGGACTGTGG + Intronic
1172380698 20:34487982-34488004 CACCACAAAGAGCTGGAGTGAGG - Intronic
1178544534 21:33481599-33481621 AAGAAGGATGAGCTGGAGTGTGG - Intergenic
1183025388 22:35061902-35061924 CAAAATAATAAGCTAGAGAGAGG - Intergenic
1183236673 22:36624031-36624053 CATATTAATGAGATGAGGTGAGG - Intronic
1183870356 22:40737107-40737129 CAAAATTAGGAGCTTGAGTGGGG - Intergenic
1203304433 22_KI270736v1_random:99349-99371 GATAAAAATAAACTGGAGTGCGG + Intergenic
951511332 3:23506004-23506026 CATAATAATAATCTAGAGTAAGG - Intronic
953689283 3:45104148-45104170 TATAATAATCAGGTGGACTGTGG + Intronic
954005603 3:47588158-47588180 CACCACCATGAGCTGGAGTGGGG - Exonic
956309391 3:67862180-67862202 CATATTAATGTGCTGGTGTTGGG + Intergenic
957927939 3:86839267-86839289 CATATGAATTTGCTGGAGTGGGG + Intergenic
960536864 3:118824546-118824568 CATAAAAATCAACTGGAGAGTGG - Intergenic
963685942 3:148434239-148434261 CCTAATAAATAGCTGGAGAGGGG - Intergenic
966570871 3:181441589-181441611 CAGAATCCTGAGCTGGACTGGGG + Intergenic
970743453 4:19266051-19266073 AAAAATAATGAGCTGGAGAGGGG - Intergenic
972205492 4:36767059-36767081 CATGTTTTTGAGCTGGAGTGAGG + Intergenic
973719739 4:53711274-53711296 CAATATAATGAGATGGAATGGGG - Intronic
975824955 4:78309612-78309634 CATTATAATGAGCAGTAGAGTGG - Intronic
976959947 4:90958034-90958056 CTTAATTATGTGCTGGAGTTTGG - Intronic
978511017 4:109518155-109518177 ATTAGTAATGAGCTGGATTGTGG + Intronic
978703244 4:111674694-111674716 CATATTAATGGGGTGCAGTGTGG - Intergenic
981231836 4:142365644-142365666 CATTCTAATGAGCTGCTGTGTGG - Intronic
983299725 4:165909577-165909599 CTTTAGAATGAGCTGAAGTGAGG + Intronic
983662783 4:170147150-170147172 TATATTAATTAGCTTGAGTGTGG - Intergenic
983778361 4:171637519-171637541 CACAAAAATTAGCTGGAGAGTGG - Intergenic
986535098 5:8778346-8778368 CCTAAGAATGGGCTGGAGTTTGG - Intergenic
988138791 5:27209051-27209073 TAAAAAAAAGAGCTGGAGTGAGG + Intergenic
989422762 5:41259059-41259081 ACTAATAATGAACTGGAGTCTGG + Intronic
992376883 5:76197059-76197081 CATGATAATGGGCAGGAGTAGGG - Intronic
992571034 5:78057808-78057830 GATCATAATGGGCTGGAGTAGGG - Intronic
993465864 5:88246107-88246129 CATAGTAAAGAGATAGAGTGAGG - Intronic
994063089 5:95503717-95503739 TGTAATAATGAGATGGGGTGGGG - Intronic
995463842 5:112430471-112430493 AATAATAAAGAGTTGGAGTAAGG + Intergenic
996414993 5:123200888-123200910 CATAACAATGACATGAAGTGTGG - Intergenic
997414429 5:133714122-133714144 CACAATAATGATCTGGACAGAGG + Intergenic
1001917578 5:175574572-175574594 CATTAAAATGAGGTGGAATGAGG + Intergenic
1002180295 5:177427694-177427716 CATGTTACTGAGGTGGAGTGTGG - Intronic
1002718752 5:181245638-181245660 CAACGTACTGAGCTGGAGTGTGG + Intronic
1002890254 6:1325859-1325881 CAGCAGAATGAGCTGGGGTGGGG - Intergenic
1002913562 6:1510272-1510294 CCTACCAATGAGCTGGAGTAGGG + Intergenic
1008565837 6:52767077-52767099 AATAATAATGTGTTTGAGTGAGG + Intergenic
1008570024 6:52807416-52807438 AATAATAATGTGTTTGAGTGAGG + Intergenic
1009369293 6:62880601-62880623 CATAATATTTAGGTGGAGAGAGG + Intergenic
1010189071 6:73176074-73176096 CATAAGAATGAGCAGGAATGTGG + Intronic
1010817608 6:80376733-80376755 AATAATGAAGAGTTGGAGTGTGG + Intergenic
1014216562 6:118757450-118757472 CATTATTATGGGCTGAAGTGTGG - Intergenic
1015038942 6:128692884-128692906 ATAAATAATGAGCTGGTGTGGGG - Intergenic
1015772814 6:136786221-136786243 CAAAAAAATTAGCTGGAATGTGG + Intronic
1021498007 7:21297663-21297685 CATGATAAAGAACTGCAGTGTGG + Intergenic
1021843718 7:24744045-24744067 AATAATGATGAGCTATAGTGTGG + Intronic
1022493233 7:30836841-30836863 GATTACAATGAGCTGGATTGGGG - Intronic
1023197876 7:37662119-37662141 CATACTAATGTGGTGCAGTGTGG + Intergenic
1024125090 7:46286050-46286072 TATTATAATGAGCTGAAGTTGGG - Intergenic
1024290808 7:47802366-47802388 CGCAACAGTGAGCTGGAGTGTGG + Intronic
1026140128 7:67698636-67698658 CATTAAAATGAGGTGGAGTTGGG + Intergenic
1031367190 7:120917248-120917270 CATAACATTGTGCTTGAGTGGGG - Intergenic
1031423807 7:121581655-121581677 TTTAATAATGTGCTGGAATGGGG + Intergenic
1033000037 7:137493341-137493363 CATGCTCATCAGCTGGAGTGGGG - Intronic
1035996926 8:4558432-4558454 CCTAATAATCAGCTTAAGTGAGG + Intronic
1036424068 8:8627138-8627160 CATACTAAAGAGCTGGTGTCTGG - Intergenic
1036732579 8:11279020-11279042 CATAAGAAAGACCTGGAATGAGG + Intergenic
1039247983 8:35630780-35630802 CAGAATAATGTACTGGGGTGGGG + Intronic
1039740111 8:40375065-40375087 CTCAATTATGAGATGGAGTGGGG + Intergenic
1041186957 8:55310983-55311005 AATAATAACCAGCTGCAGTGGGG - Intronic
1042401769 8:68357931-68357953 CATGATAATGGGCTAGAGTCTGG - Intronic
1044663333 8:94612603-94612625 CATAATAGACAACTGGAGTGAGG - Intergenic
1044819002 8:96143524-96143546 CAAAAAAATGGGCAGGAGTGGGG - Exonic
1045909880 8:107394523-107394545 CAGAATAAGGAGCTGGGGGGAGG + Intronic
1051040291 9:12801398-12801420 CATAATAAGGAACTGGGGTATGG - Intronic
1051232543 9:14967661-14967683 CTTAATATTGAGGAGGAGTGAGG - Intergenic
1051726264 9:20090140-20090162 GGTAATAATGAGCAGGAGTGTGG - Intergenic
1051961116 9:22763960-22763982 TACATTAATGAGCTTGAGTGTGG + Intergenic
1052646673 9:31245153-31245175 AATAATAGTGATCTGGATTGTGG - Intergenic
1055350071 9:75377762-75377784 CAAAATAATGACCTGGAGAAGGG + Intergenic
1057419819 9:94902325-94902347 CAGCAAACTGAGCTGGAGTGGGG + Intronic
1186436081 X:9544154-9544176 CATAATAATTAGTAGGAGTTTGG - Intronic
1186661918 X:11677039-11677061 CCTTTTATTGAGCTGGAGTGTGG + Intergenic
1189003788 X:36973853-36973875 CAGAATAGGGAGTTGGAGTGGGG + Intergenic
1189564701 X:42229560-42229582 CATTATTATGAGATGGATTGGGG + Intergenic
1193317020 X:80076560-80076582 CCTAATAATGAGCAGGGTTGTGG + Intergenic
1195464046 X:105159990-105160012 CAAAAAAATGGGGTGGAGTGGGG - Intronic
1196125531 X:112094845-112094867 AGTTATAATGAGCTGGACTGAGG + Intergenic
1198098540 X:133403849-133403871 CACAAAAATTAGCTGGGGTGTGG - Intronic
1198156988 X:133970706-133970728 CAAAAAAATGAGCTGGGGGGTGG + Intronic
1198198733 X:134392950-134392972 CAAAAAAATTAGCTGGGGTGTGG - Intronic
1200821436 Y:7587675-7587697 CATAAGAATTAGCTGGGGTTGGG - Intergenic
1202238868 Y:22745077-22745099 CATAAGAATTAGCTGGGGTTGGG + Intergenic
1202375557 Y:24232585-24232607 CATAATAAAAAGCTGGTGTTAGG + Intergenic
1202495223 Y:25437534-25437556 CATAATAAAAAGCTGGTGTTAGG - Intergenic