ID: 1138340153

View in Genome Browser
Species Human (GRCh38)
Location 16:56283878-56283900
Sequence ATGGAGCAGCAGAATGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 339}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138340153_1138340158 6 Left 1138340153 16:56283878-56283900 CCCATCTCATTCTGCTGCTCCAT 0: 1
1: 0
2: 2
3: 24
4: 339
Right 1138340158 16:56283907-56283929 GATGGAACATAGGTTTCATCTGG 0: 1
1: 0
2: 0
3: 10
4: 98
1138340153_1138340157 -4 Left 1138340153 16:56283878-56283900 CCCATCTCATTCTGCTGCTCCAT 0: 1
1: 0
2: 2
3: 24
4: 339
Right 1138340157 16:56283897-56283919 CCATTTTGCAGATGGAACATAGG 0: 1
1: 0
2: 4
3: 39
4: 429
1138340153_1138340159 16 Left 1138340153 16:56283878-56283900 CCCATCTCATTCTGCTGCTCCAT 0: 1
1: 0
2: 2
3: 24
4: 339
Right 1138340159 16:56283917-56283939 AGGTTTCATCTGGTCCAAACTGG 0: 1
1: 0
2: 2
3: 13
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138340153 Original CRISPR ATGGAGCAGCAGAATGAGAT GGG (reversed) Intronic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
902975143 1:20083097-20083119 AGGGAGCAGCAGAGAAAGATTGG + Intronic
903043060 1:20546464-20546486 ATGGAGCAGGAGGAAGAGAGAGG - Intergenic
904236346 1:29119881-29119903 CTCGGGCAGCAGAATCAGATTGG + Exonic
904599269 1:31664842-31664864 ATGGAGGAGTAGAATGTGATAGG - Intronic
905386180 1:37605892-37605914 CTGGAGCAGGACACTGAGATGGG - Intergenic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907526895 1:55058987-55059009 ATGGAGCACCTGAGTGAGAGGGG - Intronic
907736200 1:57115064-57115086 GTGGAGCTGCAGAATGGGACTGG - Intronic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
909252924 1:73381311-73381333 AGGGAGCAGGAGAGTGAGGTGGG - Intergenic
909344887 1:74573169-74573191 AGGGAGCAGCAGAAGCAGAAGGG - Exonic
910470076 1:87543050-87543072 ATGGTCCTGCAGAATGAGTTTGG + Intergenic
910501768 1:87900590-87900612 ATGAAGAAGGAGAAAGAGATGGG - Intergenic
911508697 1:98785266-98785288 TTGGAGTACCAGAAGGAGATGGG + Intergenic
911857098 1:102892574-102892596 ATGCAGCAGCTCTATGAGATAGG - Intronic
912281242 1:108316680-108316702 AGGGAGCAGAAGTATGAAATGGG - Intergenic
912474136 1:109924929-109924951 ATGGAGCTGCAGAACAGGATGGG + Intronic
917475228 1:175363570-175363592 ATGCTGCATCAGAATGAGAGTGG - Intronic
918157374 1:181862169-181862191 CTGGATCAGGAAAATGAGATAGG + Intergenic
919248738 1:195025135-195025157 ATGGACTAACAGAATGAAATGGG - Intergenic
919744963 1:201003058-201003080 AGGTAACAGCAAAATGAGATGGG - Intronic
919976285 1:202615176-202615198 ATGAAGCAGCAGCAGCAGATTGG + Intronic
920754471 1:208715997-208716019 CTGGATCAGCAGAATGATTTTGG + Intergenic
922615503 1:226958858-226958880 ATGGAGCAGCAGGAAGAAGTAGG + Intronic
923471119 1:234291908-234291930 AAGAAGCACCAGACTGAGATGGG + Intronic
924059334 1:240155302-240155324 CCTGGGCAGCAGAATGAGATTGG - Intronic
1062944367 10:1449355-1449377 AGGGGGCAGCTGAATGATATAGG - Intronic
1063437130 10:6043356-6043378 CTGGAGGGGAAGAATGAGATTGG + Intronic
1063477931 10:6344815-6344837 GTGGTGGAGCAGAATGATATAGG + Intergenic
1064319525 10:14290644-14290666 AAGGAACAGCATCATGAGATTGG + Intronic
1064876510 10:20000994-20001016 CTGGAGTAGCAGGATGAGCTGGG + Intronic
1065383375 10:25111687-25111709 AGAGAGAAGCAGGATGAGATGGG - Intergenic
1067557436 10:47282682-47282704 AGTGAGCAGCAGCATGAGCTTGG + Intergenic
1068033756 10:51735019-51735041 CTGAAGAAGCAGAGTGAGATAGG + Intronic
1068863551 10:61870881-61870903 ATTGAGCTGCAGTAAGAGATCGG + Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071054132 10:81489357-81489379 AAGGAGCAGCAGAATTTGAGGGG + Intergenic
1071059219 10:81549641-81549663 TAGGAGCACCAGAAGGAGATGGG + Intergenic
1071071448 10:81698432-81698454 TTGGAGTACCAGAAGGAGATGGG + Intergenic
1071077064 10:81767761-81767783 TTGGAGTACCAGAAGGAGATGGG - Intergenic
1071786854 10:88910537-88910559 ATGTAGCATCAGAATTAGAAGGG - Intronic
1074939252 10:118218668-118218690 ATGGAACATCAGAATGTGATGGG + Intergenic
1075922207 10:126223316-126223338 AGGGAGCAGAAGAATGTGACAGG - Intronic
1076479097 10:130772658-130772680 AAGGAGCAGGAGATTCAGATGGG - Intergenic
1077285152 11:1762292-1762314 AGGGAGCTCCAGACTGAGATCGG + Intronic
1077498850 11:2899892-2899914 ATGAAGCGGCAGGAGGAGATGGG - Intronic
1078393231 11:10954768-10954790 GTGGAGCAGAAGAAAGAGAGAGG - Intergenic
1080746781 11:35115492-35115514 AAGCAGCAGCAAAATGAGAGAGG + Intergenic
1080866166 11:36197210-36197232 ATGAGGCAGCAGAATGAAAGAGG - Intronic
1080879310 11:36304223-36304245 ATGGATCTGCAGAATAAAATGGG + Intronic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1081589032 11:44408012-44408034 ATGGAACAGCAGAGTGGGAGGGG + Intergenic
1081854004 11:46292591-46292613 ATGGAGCAGAGAAATGACATAGG + Intronic
1082556450 11:54568302-54568324 TGGGAGGGGCAGAATGAGATTGG + Intergenic
1082939385 11:58687933-58687955 ATAGAGCAGTAGAAAGAGAAGGG + Intronic
1083024546 11:59539250-59539272 CTGCAACAGCAGAATGAAATTGG + Intergenic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1086213896 11:84353944-84353966 ATGGAGGAGAGGAATGAGAGTGG - Intronic
1086269697 11:85046809-85046831 ATGGAGCAGAAGAAAGAGTTAGG - Intronic
1086435048 11:86771845-86771867 AGGGAACAGCAGAGTGTGATGGG + Intergenic
1086772321 11:90781923-90781945 ATTGAGCACTAGAATGAGCTTGG + Intergenic
1087165712 11:95000217-95000239 TTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1087728611 11:101752963-101752985 AAGAAGCACCAGAAAGAGATTGG + Intronic
1088912329 11:114201060-114201082 ATGGTGGAGCAGAAAGCGATAGG - Intronic
1088989311 11:114938025-114938047 GTGGAGCAGGAGAAAGAGAGAGG - Intergenic
1089175853 11:116548300-116548322 ATGGAGCAGCTGAGGGAGAGTGG - Intergenic
1090332338 11:125941853-125941875 TTGGAGCAGCAGCATGTGAAAGG - Intergenic
1091070015 11:132554203-132554225 GTGGAACAGCAGACTGACATGGG - Intronic
1091998215 12:5011849-5011871 ATGGAGAAGCAGAATCAAAGAGG + Intergenic
1092835832 12:12487162-12487184 CTGATGCAGCAGAATGGGATTGG - Exonic
1095168419 12:39003226-39003248 ATGGAAAAGCAGAAGGGGATGGG - Intergenic
1096038745 12:48495527-48495549 ATGGAGCAGGAGAGTGAAAAGGG - Intronic
1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG + Intergenic
1097356261 12:58605639-58605661 ATGTAACAGCAGATTCAGATGGG + Intronic
1097410223 12:59243334-59243356 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1097437421 12:59568346-59568368 ACTGAGAAGCAGAATGAGAGGGG + Intergenic
1098307739 12:69118372-69118394 ATGGACCAGCAATATGTGATGGG - Intergenic
1098309776 12:69136888-69136910 AGATAGCAGAAGAATGAGATAGG - Intergenic
1099062512 12:77929681-77929703 ATGGTGCAGCAGCATGATCTCGG + Intronic
1099328270 12:81247419-81247441 ATGTAACAGCAGAATGAGATAGG + Intronic
1101014451 12:100485115-100485137 ATAGAGCTGCAGAATGTGACTGG - Intronic
1103876646 12:124132680-124132702 CTGGGCCAGCAGAATGAGAATGG - Intronic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106889981 13:34234833-34234855 TTGGAGTACCAGAAGGAGATGGG - Intergenic
1107626008 13:42284867-42284889 TTGAAGCAGCAGCATGAGAAAGG - Intronic
1108058560 13:46509670-46509692 ATGGAGCAAGAGAGGGAGATGGG - Intergenic
1108160568 13:47633848-47633870 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1108292062 13:48971902-48971924 ATGGGACAGCAGATTGAGGTGGG - Intergenic
1108420610 13:50245311-50245333 ATGAAGAAGCAGAATTAGAGAGG - Intronic
1109080901 13:57899449-57899471 ATGCAGCAGCAGGAAGATATGGG - Intergenic
1109131663 13:58594303-58594325 AAGCAGCAGAAGATTGAGATGGG + Intergenic
1110260375 13:73477790-73477812 TTGGAGGAGCAGATTGGGATAGG - Intergenic
1112722881 13:102265141-102265163 ATGGAGGATGAGAATGAGAAAGG - Intronic
1114526379 14:23369202-23369224 ATGAAACAGCATTATGAGATAGG - Intergenic
1114690487 14:24575560-24575582 ATGGGGCAGCAGATTGGGAGGGG + Intronic
1114706123 14:24728043-24728065 TTGGAGTACCAGAATTAGATGGG + Intergenic
1115121250 14:29940713-29940735 CTGGAGCAGGAGGATGAGTTGGG - Intronic
1115152711 14:30303744-30303766 ATGCTGCAGGAGAATGAGAGTGG - Intergenic
1116181079 14:41536648-41536670 ATGAAGCAGAAGAATGAAACTGG - Intergenic
1116690024 14:48093889-48093911 ATGGGGCAGGAGAAAGAGATAGG + Intergenic
1120008864 14:79390422-79390444 CTGTAGCAGCAGAAAGAGGTAGG - Intronic
1120014215 14:79451730-79451752 CTGGAGCAGCAGAATGCAAAGGG - Intronic
1121558470 14:94856521-94856543 GTGGAGCTGCAGAATGTGCTCGG - Intergenic
1124046384 15:26154613-26154635 TTGGAGTACCAGAAAGAGATGGG - Intergenic
1124548967 15:30659919-30659941 ATGGAGTAGCTGTAGGAGATGGG + Intronic
1128680874 15:69650441-69650463 CTGGTGCAGAAGAATGAGTTAGG - Intergenic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1128805245 15:70526137-70526159 AGGCAGAAGCAGAATGAGTTGGG - Intergenic
1128883243 15:71262503-71262525 ATGGGGCTGCAGCATGAGACTGG + Intronic
1130099141 15:80878873-80878895 AGGGAGCAGCAGAGAGAGATTGG - Intronic
1131614673 15:94003938-94003960 AGGGGGCAGCAGAAGGAGAATGG - Intergenic
1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG + Intronic
1131885022 15:96903175-96903197 GAGGAGCAGTAGAAGGAGATTGG - Intergenic
1133070900 16:3246300-3246322 ATGGAGCTGCAGACTGGGAAGGG - Intronic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1134818654 16:17227743-17227765 ATGGAGCAGGAGAAAGAGTTGGG + Intronic
1134870804 16:17650772-17650794 ATGGAACACCAGCATGAGAAAGG + Intergenic
1135165385 16:20134477-20134499 GTGGAGCAGCAGATCCAGATTGG + Intergenic
1135857735 16:26027523-26027545 TTGGAGAAGCAAAATGAGATAGG - Intronic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138389271 16:56658362-56658384 TTTGAGCAGCAGGATTAGATAGG + Intronic
1139330961 16:66189555-66189577 ATGGAGCAGCAGCCAGAGCTGGG - Intergenic
1141001565 16:80313072-80313094 AAGAAGTAGAAGAATGAGATGGG + Intergenic
1141138228 16:81480575-81480597 CTGGAGCAGCAGAATGGGTCAGG - Intronic
1141286379 16:82676329-82676351 ATGGTGCCACAGAATGAGGTAGG - Intronic
1143612918 17:8030296-8030318 AGGGCTAAGCAGAATGAGATAGG - Intergenic
1144227442 17:13163390-13163412 CTGGAGCAGGAGCAAGAGATGGG + Intergenic
1144523740 17:15972090-15972112 ATGGGGCAGGAGAATGGGAGTGG + Intronic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1145904638 17:28509417-28509439 ATGGAGCAGGAGGTGGAGATGGG - Intronic
1146889632 17:36497952-36497974 ATGGAGCATCAGAATCAGCTGGG + Intronic
1146950917 17:36905612-36905634 ATGGAGCACCAGAAAAGGATAGG - Intergenic
1149381445 17:56098059-56098081 AGAGAGAAGCAGAAGGAGATTGG + Intergenic
1149514602 17:57270864-57270886 ATAGAACAGCACATTGAGATTGG + Intronic
1150490106 17:65568529-65568551 CTGAAGCAGGAGAATGACATGGG - Intronic
1151534252 17:74729759-74729781 GTGGAGCCCCAGAAGGAGATGGG - Intronic
1151961047 17:77405834-77405856 ATGGAGGGGCAGAAGGGGATGGG - Intronic
1153493069 18:5669787-5669809 ATGGGACAGCTGCATGAGATGGG - Intergenic
1156687516 18:39667947-39667969 ATGGAGAGGCAGAATGGTATGGG - Intergenic
1156708195 18:39909542-39909564 ATGGAGGAGCAGCTTGAGAAAGG - Intergenic
1157418791 18:47527533-47527555 ATGGAGGAGGAGACTGAGCTGGG + Intergenic
1157584204 18:48790892-48790914 ATGGCCCAGCAGAAGGAGAAGGG - Intronic
1158055409 18:53273715-53273737 AAAAAGCAGCAGAAAGAGATAGG - Intronic
1158971753 18:62674631-62674653 ATGAAGGAGCTGAAGGAGATGGG - Intergenic
1159345130 18:67192271-67192293 ATGGAGAAACAAAAAGAGATGGG - Intergenic
1159952182 18:74492714-74492736 TTGGAGCTGGAGAATTAGATTGG + Intergenic
1161390640 19:4018685-4018707 AAGGAGCAGCAGAGTGATGTAGG + Intronic
1164710903 19:30356630-30356652 TTGTAGCTGCTGAATGAGATCGG + Intronic
1164753175 19:30670912-30670934 ATAGAGCAGCAGAATGTTCTTGG - Intronic
1165860130 19:38905094-38905116 ATGGACCTGCAGAATGACCTAGG + Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167371367 19:49084524-49084546 ATGGAGCAGAATAAAGGGATGGG - Intergenic
1168473712 19:56661096-56661118 AGAGAGCAGCAGAAAGAGCTGGG - Intergenic
926811012 2:16755427-16755449 ATGGAGCTGCAGAGAGAGGTGGG + Intergenic
927240556 2:20916606-20916628 ATGGAGAGGCAGAGAGAGATGGG - Intergenic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
931243273 2:60471384-60471406 AAGAAGCAGCAGAATCAGCTGGG - Intronic
931709506 2:64976375-64976397 ATGGTACAGCAGTATGATATAGG - Intergenic
932688175 2:73891295-73891317 GTGCAGCAGCAGCATGATATGGG - Intergenic
932814179 2:74848829-74848851 TTGGGCCTGCAGAATGAGATGGG + Intronic
933502874 2:83138874-83138896 AAGGAGCAGGAGAAGGAGAAGGG + Intergenic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
935926071 2:108070288-108070310 AGGGAGCAGCAGAAAGGGACAGG - Intergenic
936910610 2:117588696-117588718 ATTGAGGAGAAGAATGAAATAGG - Intergenic
936997019 2:118426256-118426278 GTGAAGCAGCAAGATGAGATTGG - Intergenic
937278699 2:120702841-120702863 AGGAAGGAGCAGAATGAGGTCGG - Intergenic
937449621 2:121991475-121991497 ATGAAGCAGCTCAGTGAGATGGG + Intergenic
937530262 2:122819459-122819481 TTGGAGCAGAAGCATGACATGGG + Intergenic
937791460 2:125967052-125967074 TTGGAGCAGAAGGAGGAGATTGG - Intergenic
937931664 2:127209890-127209912 CTGGAGCACCAGAAGGAGACGGG + Intronic
939053403 2:137332986-137333008 AGTGAGCAACAGAATGAGTTAGG + Intronic
939809126 2:146809409-146809431 CTGGAGTACCAGAAGGAGATGGG + Intergenic
939881720 2:147639260-147639282 ATAGGGCAGCAGAGGGAGATGGG - Intergenic
941105806 2:161351463-161351485 ATGGATGAGCAGAATGGTATGGG - Intronic
945192280 2:207201362-207201384 ATGGTGCAGTAGAAAGAGAATGG - Intergenic
945921350 2:215757900-215757922 AAGGAGCAAGAGAAAGAGATGGG - Intergenic
946749995 2:222884619-222884641 ATAGAGAGGCAGAAGGAGATTGG - Intronic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948590008 2:239043214-239043236 CTGGAGCAGGAGCAAGAGATGGG - Intergenic
1169920216 20:10726978-10727000 AGTGAGCAGCAGAATGGGACTGG + Intergenic
1170426220 20:16237823-16237845 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1170968211 20:21095130-21095152 TTTGACCAGTAGAATGAGATGGG + Intergenic
1173040567 20:39458570-39458592 AAGGAGGAGCAGCATGAGAGGGG + Intergenic
1173411922 20:42818926-42818948 CTGAAGTAGCAGAAAGAGATGGG + Intronic
1174406435 20:50306166-50306188 ATGAAGCAGGAAAAGGAGATGGG + Intergenic
1175128999 20:56775118-56775140 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1175670313 20:60896916-60896938 GTGGTGCAGCCGAATGTGATGGG + Intergenic
1178056369 21:28803470-28803492 CTGTAGCAGTAGATTGAGATTGG - Intergenic
1181239420 22:21468466-21468488 GCGGAGCAGCAGCATGAGCTGGG + Intergenic
1181828477 22:25539349-25539371 CTGGAACAGAAGAAGGAGATTGG - Intergenic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1182996294 22:34815959-34815981 CTGGAGCAGGAGAAAGAGACGGG + Intergenic
1183981270 22:41541928-41541950 GTGGAGCATCAGAAGGTGATGGG - Intronic
1184032676 22:41904198-41904220 AGGGAGCAGCAGAATGGAAATGG - Intronic
1184956404 22:47889718-47889740 CTGGAGCAGGAGAAAGAGAGAGG - Intergenic
950748003 3:15106053-15106075 ATGGAACAGCAGACTGGGTTCGG - Intergenic
951178562 3:19631343-19631365 ATGGAAAATCACAATGAGATAGG - Intergenic
951505128 3:23436312-23436334 ATGGAACAGCAGAATGAACCTGG - Intronic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
952258375 3:31714831-31714853 CTGGAGCAGAAGGATGAGCTGGG - Intronic
952352689 3:32555684-32555706 AGAGAGTAGCATAATGAGATCGG - Intronic
953311326 3:41882775-41882797 ATGGAGTAGCTGTAGGAGATGGG - Intronic
953685316 3:45073582-45073604 ATGGTGAAGGAGAAAGAGATAGG + Intergenic
955086236 3:55705675-55705697 ATGGATCAGCTGAATGAATTTGG - Intronic
957394882 3:79623721-79623743 TTGGAGTACCAGAAGGAGATGGG + Intronic
957639123 3:82827614-82827636 ATGAAGCAGAAGAAAGAGAGGGG - Intergenic
957911174 3:86621527-86621549 ATGAAGCAGCAGAAGGAAATAGG + Intergenic
958174509 3:89979061-89979083 ATGAAGCAGCAGCATGACTTGGG + Intergenic
958834592 3:99130012-99130034 ATAGAGCAGGAGAAAGAGAGAGG + Intergenic
960337046 3:116430425-116430447 ATGGAGTAGAAGATTGAAATGGG - Intronic
960413885 3:117360258-117360280 TTGGAGTACCAGAAGGAGATGGG + Intergenic
960477111 3:118143898-118143920 TTGGAGTACCAGAAGGAGATGGG - Intergenic
960603286 3:119479262-119479284 ATGGATGAGCAAAATGAGAAGGG - Intronic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
962099972 3:132331653-132331675 ATGGAGCAGCATTATGAACTTGG + Exonic
962998872 3:140657463-140657485 TTGGAGCACCTGAAAGAGATAGG + Intergenic
963867565 3:150379032-150379054 CTGGAGCAGGAGCAAGAGATGGG - Intergenic
966066375 3:175826798-175826820 TTGGAGCAGAAGGATGAGAAAGG - Intergenic
967019252 3:185508078-185508100 ATGGAGGAGCTGGAGGAGATGGG - Exonic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
967466156 3:189808305-189808327 ATGGACCAGCAGATTCAGAACGG + Exonic
969871349 4:10106996-10107018 TTGGGGAAGAAGAATGAGATTGG + Intronic
970494455 4:16610739-16610761 CTGGAGTACCAGAATGTGATGGG + Intronic
971261743 4:25063488-25063510 ATGGAGCAGAAGAATGGTAGAGG + Intergenic
971725312 4:30304187-30304209 TTGGAGCAGGAGAAAGAGAGAGG + Intergenic
971746298 4:30585857-30585879 TTGGAGTAGCTGAAAGAGATGGG - Intergenic
972242022 4:37203768-37203790 GTGGAGCAGCACAATATGATGGG - Intergenic
973090489 4:46129981-46130003 ATGGAGCAGGAGAGAGACATAGG - Intergenic
973589711 4:52428626-52428648 TTGGAGCATTAGAATGAGCTGGG + Intergenic
973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG + Intergenic
973749292 4:53997336-53997358 ATGTAGCTGCAGAATTAGAAAGG + Intronic
974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG + Intergenic
975621877 4:76304950-76304972 ATGGAGCAGGGGAAGGATATAGG + Intronic
976502336 4:85806049-85806071 ATGAAGCAGCTGAATGGGGTAGG - Intronic
977481438 4:97582124-97582146 ATAGAGCAGAAGTAGGAGATGGG - Intronic
978312920 4:107405641-107405663 ATGGAGGAGGAAAATGAAATAGG + Intergenic
979197681 4:117940348-117940370 TTGGAGTATCAGAAGGAGATGGG - Intergenic
979555922 4:122047505-122047527 AAGGAGCAAGAGAATGAGACAGG + Intergenic
979564668 4:122141187-122141209 GTGGCCCAGCAGAATGAGTTTGG + Intergenic
979775594 4:124584595-124584617 TTGGAGTACCAGAAGGAGATGGG + Intergenic
981666635 4:147234455-147234477 ATGGGGCAAGAGAATGAGAGAGG + Intergenic
982325128 4:154122158-154122180 ATGAAGGAGGAGAATGAGATGGG - Intergenic
983015113 4:162603957-162603979 AAGGTGCAGCAGAAAGAAATAGG + Intergenic
983924480 4:173385107-173385129 TTGCAGCAACTGAATGAGATAGG - Exonic
984625950 4:182008350-182008372 TTGGAGTACCAGAAGGAGATGGG - Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984997099 4:185444999-185445021 AAGGGTCAGCAGAATGTGATGGG - Exonic
986229696 5:5852077-5852099 ATGCAGCAGGAGAATAAGGTAGG - Intergenic
987165510 5:15194134-15194156 AGGGAGCACCAGCATGTGATGGG + Intergenic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
988852151 5:35190755-35190777 ACAGTGCAGCAGAATAAGATGGG - Intronic
991035875 5:62126951-62126973 ATGCAGCAGCAGAAAAAGAATGG + Intergenic
991557930 5:67916647-67916669 ATGGAAGAGAAGAGTGAGATGGG - Intergenic
991698965 5:69299440-69299462 ATGGAGCAGTAGAGTGATAGGGG - Intronic
992704736 5:79379763-79379785 AATGAGCAGAAGAATGAGTTTGG - Intronic
993584752 5:89710590-89710612 ATGGAACACCTGCATGAGATAGG + Intergenic
994662212 5:102667618-102667640 CAGTAGCAGCAAAATGAGATTGG + Intergenic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
995614827 5:113950194-113950216 TGGGAGCAGCAGAATGAGGGAGG - Intergenic
998053196 5:139053490-139053512 TTGAAGCAGGAGAATGACATAGG - Intronic
999065267 5:148678811-148678833 ATAGTGGAGAAGAATGAGATGGG - Intergenic
999104585 5:149059791-149059813 AGAGAGAAGGAGAATGAGATTGG + Intronic
1000807709 5:165817182-165817204 ATTGTGGAGCAGAATGAGTTAGG + Intergenic
1001400730 5:171444997-171445019 ATGGAGCAGGGGAATGGGGTAGG + Intronic
1002815024 6:671560-671582 AGGGAGAAGCAAAATGATATAGG - Intronic
1003233003 6:4271784-4271806 ATGGAACAGCTGGATGAGAGTGG - Intergenic
1003686942 6:8313943-8313965 TTGGAGTACCAGAAGGAGATGGG - Intergenic
1003806340 6:9729459-9729481 ATGAATCAGGATAATGAGATAGG + Intronic
1003822762 6:9918284-9918306 ATGGAGGAGCAGCATGTGGTGGG - Intronic
1005573422 6:27169162-27169184 ATGGAGTAGAAGAATTACATTGG - Intergenic
1005575478 6:27185527-27185549 GTGGACCACCAGAATAAGATAGG - Intergenic
1006998489 6:38285392-38285414 ATGGTGCCACTGAATGAGATGGG + Intronic
1007183383 6:39947023-39947045 ATTGATTAGCAAAATGAGATGGG - Intergenic
1007212762 6:40208921-40208943 AAGGAGAAGCAGATTTAGATGGG - Intergenic
1007720530 6:43882604-43882626 ATGGAGCAGGAAAACCAGATGGG - Intergenic
1007995493 6:46303444-46303466 AAGTAGCACCATAATGAGATTGG - Intronic
1008773485 6:55007997-55008019 TTGGAGTACCAGAAGGAGATGGG - Intergenic
1010857816 6:80863861-80863883 ATAGAGAAGAAAAATGAGATAGG + Intergenic
1011878001 6:91986052-91986074 ATTGACCATCAGAATGAGAATGG + Intergenic
1012143204 6:95649566-95649588 GTTGAGCAGCAGGATGAGTTTGG - Intergenic
1013461683 6:110380105-110380127 TTGGAGTACCAGAAAGAGATAGG + Intergenic
1014425394 6:121298660-121298682 ATTGAGCAGCAGAAGAAGAGAGG - Intronic
1014701936 6:124699621-124699643 CTGGAGCAGCAGCAAGAGAGTGG - Intronic
1015358343 6:132306388-132306410 TTGGAGTACCAGAAGGAGATGGG + Intronic
1015804411 6:137093861-137093883 CTGGAGCAGCAGCAAGAGAGAGG + Intergenic
1016100889 6:140098758-140098780 AGGGAGCAGGAGAATGTGACGGG + Intergenic
1016477852 6:144447638-144447660 TTGGATCAGCTGAGTGAGATTGG + Exonic
1016560667 6:145392419-145392441 AAGGAGCAGTAGAAGGAGAATGG - Intergenic
1016672258 6:146722480-146722502 AGAGAGCAGCTGAATGTGATTGG + Intronic
1016707430 6:147127013-147127035 ATGGAGCAAAAGAATGACCTAGG + Intergenic
1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG + Intergenic
1018633365 6:165839793-165839815 ATGGAGCTGGAGAAGGGGATGGG - Intronic
1018926930 6:168213017-168213039 TTGGAGCAGGAGGCTGAGATAGG + Intergenic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1019113373 6:169736930-169736952 TTGGAGTAGCAGAAGGAGATGGG - Intergenic
1021373946 7:19883793-19883815 ATAGAAAAGAAGAATGAGATTGG - Intergenic
1022998631 7:35784804-35784826 ATGGAGGGGCAGAAAGAGAGGGG - Intergenic
1023363548 7:39440299-39440321 CTGGAGTACCAGAATGAGATAGG - Intronic
1023602247 7:41891637-41891659 ATGGAGCAGCACAAGGGTATGGG - Intergenic
1023787601 7:43723501-43723523 ATGGAGCAGTAGTATGATACCGG + Intronic
1023854676 7:44175475-44175497 TGGGAGCAGGAGAATGAGAGGGG + Intronic
1024432494 7:49305445-49305467 ATAGTGCAGAAGAATGAAATTGG - Intergenic
1024450689 7:49539419-49539441 ACGCAGAAGCAGAAGGAGATGGG + Intergenic
1026574401 7:71560300-71560322 AAGGAGGAGGAGAATGAGATAGG - Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026892491 7:73990432-73990454 TTTAAGCAGGAGAATGAGATGGG - Intergenic
1027818198 7:83006494-83006516 ATGAAACAGCAGTATGAGAAAGG - Intronic
1031038963 7:116818587-116818609 ATGGTGTAACAGAATGAGATAGG + Intronic
1031599200 7:123684944-123684966 ATGGAGCAGGAAAAGAAGATTGG - Intronic
1031793001 7:126134086-126134108 CTGGAGGTGCTGAATGAGATAGG + Intergenic
1033048315 7:137982022-137982044 ATGGGGCTGCACAATGAGGTGGG + Intronic
1033385926 7:140874930-140874952 CTGGAGCAGAAGCAAGAGATGGG - Intronic
1034001952 7:147424113-147424135 ATGGAGCAGCGGAATGAAGTAGG - Intronic
1035841552 8:2817291-2817313 AAGAAGCAGCAGAAAGACATGGG + Intergenic
1035921825 8:3685461-3685483 ATGCTGCAGCCGAAGGAGATGGG + Intronic
1037550881 8:19970256-19970278 TCTGAGCAGCAGAATGTGATAGG + Intergenic
1038164075 8:25067825-25067847 TTGGAGCAGCAGCTTGAGCTGGG - Intergenic
1038795810 8:30708294-30708316 ATGGGGCAGCAGAATGACACAGG - Intronic
1039685768 8:39800642-39800664 TTGGAGTATCAGAAGGAGATGGG - Intronic
1039715788 8:40107288-40107310 ATGGAGCAGCTGAATTTAATGGG - Intergenic
1039986506 8:42452314-42452336 ATGGAGGAGAAGAAAGAGATAGG + Intronic
1040294147 8:46140573-46140595 ATGGGGCAGCAGAATGGCTTGGG - Intergenic
1040550091 8:48430920-48430942 AGGGAGCAGAGGAAGGAGATAGG + Intergenic
1041180214 8:55239536-55239558 GTGGGGCAGCAGAAGGAGAGTGG - Intronic
1042644202 8:70968052-70968074 TTGGAGCACCTGAAAGAGATGGG - Intergenic
1043284639 8:78514310-78514332 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1045466332 8:102473742-102473764 AGGGAGCAGGAGAGAGAGATGGG - Intergenic
1046379142 8:113431288-113431310 AGGGAACAGAAGAAAGAGATAGG + Intronic
1046900433 8:119518068-119518090 ATGGAGCAGCACACCCAGATGGG + Intergenic
1048705442 8:137148091-137148113 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1048982090 8:139708029-139708051 ATGCTGCAGCTGAATGAGTTTGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052778265 9:32754879-32754901 ATGGGGCAGCAGTAGGTGATGGG - Intergenic
1055326111 9:75131806-75131828 ATGAAGCAGCAAAAAGAGGTAGG + Exonic
1056156994 9:83847683-83847705 ATGGCGCACCAGATTGAGGTTGG - Intronic
1056298941 9:85221983-85222005 ATTGGGAAGCAGAGTGAGATTGG - Intergenic
1056347230 9:85709468-85709490 ATTGAGCAGCTGAATGACATTGG - Intronic
1056353547 9:85775838-85775860 ATGGTGCACCAGATTGAGGTTGG + Intergenic
1056390005 9:86132146-86132168 AGAGAGTAGCAGAATGAGAGAGG - Intergenic
1057559921 9:96119296-96119318 ATAGGGCAGCCTAATGAGATGGG - Intergenic
1057577755 9:96257011-96257033 CTGGAGCAGCAGGAAGAGAAGGG - Intronic
1058002989 9:99885494-99885516 ATGTAGCAGCATAATGACAGTGG + Intergenic
1058316164 9:103569325-103569347 ATGGAGCAGCAGATTGGCTTTGG + Intergenic
1058374463 9:104306439-104306461 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1059767093 9:117393865-117393887 ATGGAGGAGGAGGAGGAGATGGG + Intronic
1059889248 9:118783042-118783064 TTGTAGCAGGAGAAAGAGATGGG + Intergenic
1060342071 9:122786482-122786504 ATGGTGAAGCAGCATGAGAGAGG + Intergenic
1061656301 9:132093169-132093191 ATGGAGGAGCAGAGGTAGATGGG + Intergenic
1062212929 9:135374209-135374231 CTGGAGCAGGAGAAACAGATTGG - Intergenic
1185846121 X:3439838-3439860 TTGGAGTACCAGAAGGAGATGGG - Intergenic
1186568434 X:10689316-10689338 TTGGAGCAGGAGAAAGAGAGAGG + Intronic
1186761742 X:12730211-12730233 ATGGGGCAGGAGGATGAGGTGGG + Intergenic
1186800493 X:13087783-13087805 AGGAAGCATCAGTATGAGATAGG + Intergenic
1188003292 X:25001638-25001660 TTGCAGCATCAGAATGACATAGG + Intergenic
1189741256 X:44119245-44119267 ATCAAGCAGGTGAATGAGATAGG - Intergenic
1190265228 X:48824071-48824093 ATGGAGCAGAGGAAGGGGATGGG + Intronic
1192093831 X:68189193-68189215 ATGGAGCAGATGGGTGAGATGGG - Intronic
1192631614 X:72781929-72781951 ATGGAGCAGCAGAAGGGGCTTGG + Intronic
1192650095 X:72938872-72938894 ATGGAGCAGCAGAAGGGGCTTGG - Intronic
1193048230 X:77075728-77075750 TTGGAGTAACAGAAGGAGATGGG - Intergenic
1195573218 X:106420134-106420156 AGGGAGCATCAGAGTCAGATAGG + Intergenic
1198673084 X:139102714-139102736 GTGGGGCTGCACAATGAGATGGG - Intronic
1198741552 X:139848426-139848448 ATGGAGCTGAAAAATGAGAGAGG - Intronic
1199049576 X:143221366-143221388 CTGGAGCAGGAGGAAGAGATGGG - Intergenic
1199319853 X:146425529-146425551 ATGGAGAAAGAGAGTGAGATAGG + Intergenic