ID: 1138343482

View in Genome Browser
Species Human (GRCh38)
Location 16:56306128-56306150
Sequence CTTTCAACAAAGAGGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 232}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138343482_1138343489 1 Left 1138343482 16:56306128-56306150 CCCTGCTCCCTCTTTGTTGAAAG 0: 1
1: 0
2: 4
3: 13
4: 232
Right 1138343489 16:56306152-56306174 AATGATTCACAGGTGTTGATGGG 0: 1
1: 0
2: 0
3: 9
4: 120
1138343482_1138343488 0 Left 1138343482 16:56306128-56306150 CCCTGCTCCCTCTTTGTTGAAAG 0: 1
1: 0
2: 4
3: 13
4: 232
Right 1138343488 16:56306151-56306173 GAATGATTCACAGGTGTTGATGG 0: 1
1: 0
2: 2
3: 11
4: 171
1138343482_1138343491 18 Left 1138343482 16:56306128-56306150 CCCTGCTCCCTCTTTGTTGAAAG 0: 1
1: 0
2: 4
3: 13
4: 232
Right 1138343491 16:56306169-56306191 GATGGGTGTCAAAGATAAAAGGG 0: 1
1: 0
2: 1
3: 21
4: 271
1138343482_1138343490 17 Left 1138343482 16:56306128-56306150 CCCTGCTCCCTCTTTGTTGAAAG 0: 1
1: 0
2: 4
3: 13
4: 232
Right 1138343490 16:56306168-56306190 TGATGGGTGTCAAAGATAAAAGG 0: 1
1: 0
2: 0
3: 15
4: 219
1138343482_1138343487 -9 Left 1138343482 16:56306128-56306150 CCCTGCTCCCTCTTTGTTGAAAG 0: 1
1: 0
2: 4
3: 13
4: 232
Right 1138343487 16:56306142-56306164 TGTTGAAAGGAATGATTCACAGG 0: 1
1: 0
2: 2
3: 17
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138343482 Original CRISPR CTTTCAACAAAGAGGGAGCA GGG (reversed) Intronic
900518985 1:3096597-3096619 CTTTCAACACACAGGCGGCAAGG - Intronic
900905774 1:5556220-5556242 CTTTCCACAAAGGGGTAACAGGG + Intergenic
904052399 1:27647683-27647705 CTTTCCTCAAACAGGGGGCAGGG - Intergenic
904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG + Intronic
905649710 1:39647997-39648019 CCTTCATCAAAGAGGGAGTTTGG - Intergenic
906609668 1:47192655-47192677 GTTCCAGAAAAGAGGGAGCATGG + Intergenic
906696009 1:47823935-47823957 CCTTCCAAACAGAGGGAGCAAGG - Intronic
907120724 1:52005890-52005912 CCTTGAACAAAGACAGAGCAGGG - Intergenic
907252523 1:53150456-53150478 ATTTCACCAAAGAGGAGGCATGG - Intergenic
909213681 1:72857696-72857718 ATATCAACATAAAGGGAGCAAGG - Intergenic
910661249 1:89675501-89675523 CCTTGAACAAAGAGGGCACAGGG - Intronic
911454668 1:98108279-98108301 CTTTCAGTAAAGTGGGAGGATGG + Intergenic
911605967 1:99905524-99905546 ATTTCAGCAAAGAGGGAAGATGG - Intronic
912696117 1:111843418-111843440 CTTTCTAGAAACAGGGAGCTTGG - Intronic
913084541 1:115424616-115424638 CTTTCAACAGTGACTGAGCAAGG - Intergenic
913167251 1:116199666-116199688 CAATCAACAAAGAGTGATCAGGG + Intergenic
916724975 1:167515486-167515508 ATTTCCACAAATAGGGGGCAGGG - Intronic
918585797 1:186186933-186186955 TTTTCAAGAAAGAGGGTCCATGG - Intronic
919560440 1:199112457-199112479 CTTTCAATAAATAGTGAGAAAGG - Intergenic
919822428 1:201481710-201481732 CCCTCACCAAAGAGTGAGCAAGG - Intergenic
920343017 1:205287453-205287475 CTTCCACCTAAGAGGGAACAGGG - Intergenic
922237197 1:223731155-223731177 TTTCCCACAAAGAGGAAGCAGGG + Intronic
923236212 1:232035692-232035714 CTTTCATCCAACAGGGACCAAGG - Intronic
923345484 1:233047526-233047548 CTTTCATCAAAAAAGGAGCAGGG + Intronic
923730406 1:236544377-236544399 CTTTCAAGAAGGAAGGAACACGG + Intronic
924642429 1:245847018-245847040 CTTTGAACAGGGAGAGAGCAGGG - Intronic
1062876454 10:946776-946798 TTTTCCACAAAGAGGGAGGGTGG - Intergenic
1066038820 10:31523918-31523940 CTTTCATCCTAGAGGGAGAAAGG - Exonic
1066361936 10:34739753-34739775 TATTCAATAAAGTGGGAGCAGGG + Intronic
1067309128 10:45095676-45095698 CCTTGAACAAAGACAGAGCAGGG - Intergenic
1067661304 10:48237990-48238012 TTTTCTGCAAAGAAGGAGCAAGG - Exonic
1067664632 10:48266597-48266619 TTTTCAACAAATAGTCAGCAAGG + Intronic
1068903792 10:62299875-62299897 CTTGCTACCAAGAGGGAGAAAGG + Intergenic
1068931013 10:62590232-62590254 ATTTCATCAATGAGGGAGCATGG + Intronic
1069786673 10:70992713-70992735 CTCTCAACAAAGAGACAGAATGG - Intergenic
1070212018 10:74334189-74334211 CTGTCAACAAAAACAGAGCAGGG - Intronic
1070253899 10:74797699-74797721 CTTTTACCAAAGAGGAACCAAGG - Intergenic
1071381089 10:85060976-85060998 CTATTAACAAAGAGGGAGCATGG - Intergenic
1072323114 10:94270608-94270630 CTCTCAACAAAAAGGCAGGATGG + Intronic
1076180011 10:128399724-128399746 CTTTCACGAAAGAGGCTGCATGG + Intergenic
1076333839 10:129691820-129691842 CTTTCAACCAGGAGAGGGCACGG - Intronic
1077372677 11:2190827-2190849 CTTTTAACAAGGAGGAAGGAAGG + Intergenic
1078088151 11:8247083-8247105 ATTTCAACAAAGAGAGACCTGGG - Intronic
1078926757 11:15882043-15882065 CTTTCAACTGAGAGGTAACATGG + Intergenic
1079667218 11:23121046-23121068 TTTTCCAGAAAGAGGGAGCAGGG - Intergenic
1081451984 11:43179800-43179822 CTTACATCAAGGAAGGAGCATGG - Intergenic
1083328615 11:61886362-61886384 CTTCCCACAAGGAAGGAGCAAGG + Intronic
1085572434 11:77571330-77571352 CATTAAACAAAGACAGAGCAGGG - Intronic
1085573005 11:77575874-77575896 CATTAAACAAAGACAGAGCAGGG - Intronic
1085745317 11:79110118-79110140 CTGGCAACAGAGAGGGAGGAGGG - Intronic
1085789325 11:79483378-79483400 CTTACCACAAAGAAGGAGGAAGG + Intergenic
1086047780 11:82553217-82553239 GTTTCAACAAAGAGCTAACAAGG + Intergenic
1087236043 11:95719750-95719772 CTTTCAACAAATGGGGAACTGGG - Intergenic
1087621807 11:100551514-100551536 GTTTCAAAAAAGAGTAAGCAAGG + Intergenic
1089304140 11:117516308-117516330 CATTCAGAAAAAAGGGAGCAGGG - Intronic
1090593362 11:128294714-128294736 CATTGAGCAAAGAGGAAGCAGGG + Intergenic
1090810891 11:130241526-130241548 ATTTCACAAAAGAGGGAGGAAGG - Intronic
1093140782 12:15508251-15508273 CTTTTAACAAAGAGTGAGCGTGG - Intronic
1095798025 12:46241736-46241758 CTTTCATCAAAGAGGGCCAAGGG - Intronic
1096198163 12:49662369-49662391 CTTCCAACAAACACTGAGCAAGG - Intronic
1097415355 12:59308979-59309001 CTTTGCACATAGAGGGATCAAGG + Intergenic
1098042453 12:66365919-66365941 CACTTACCAAAGAGGGAGCAGGG - Intronic
1098711747 12:73771683-73771705 CTCTCAGCAAAGAGGGAGTGTGG + Intergenic
1100680577 12:96915776-96915798 CATTCTATAAAGATGGAGCATGG + Intronic
1102892324 12:116569648-116569670 ATTTCAACAAAGAAGTAGAATGG + Intergenic
1103401238 12:120644420-120644442 CTGGCCACAAAGAGGGAGTACGG - Intronic
1104147397 12:126048519-126048541 CTTACAACATAGATGAAGCAAGG + Intergenic
1106356888 13:28991770-28991792 CTTTAAACAAAGGGGAAGGAGGG - Intronic
1108909610 13:55528745-55528767 CTTTCAAAATGAAGGGAGCAAGG - Intergenic
1108926465 13:55753358-55753380 GTTTCATCAAAGAGGGAGGCCGG - Intergenic
1108937282 13:55898853-55898875 ATTGCGAGAAAGAGGGAGCATGG - Intergenic
1109527491 13:63596119-63596141 CTTTCATCAGAGAGGGGACATGG + Intergenic
1109721346 13:66280273-66280295 ATTTTAAAAAAGTGGGAGCAAGG + Intergenic
1110039230 13:70731063-70731085 GTTTTAACAGAGTGGGAGCAAGG - Intergenic
1110289776 13:73790896-73790918 CTTTCATGGAAGAGAGAGCATGG - Intronic
1110421331 13:75312886-75312908 CTTTCAACAGTGATGGAGAAGGG - Exonic
1111683022 13:91467295-91467317 CTGTCACCACAGAGGGAGAAAGG + Intronic
1111970058 13:94902729-94902751 GTGTCACCAAAGAGTGAGCATGG - Intergenic
1112839409 13:103558025-103558047 CTGTCACCATAGTGGGAGCATGG + Intergenic
1113851274 13:113419822-113419844 CTTTCCCCAAACAGGAAGCATGG - Intergenic
1115245553 14:31290485-31290507 TCTTCAACAAAGAGTGAGGAAGG + Intergenic
1116301063 14:43184274-43184296 CTTTCAACAAACTGGGAATAAGG + Intergenic
1117142926 14:52808236-52808258 CTTTCACCTAAGAGGCATCATGG + Intergenic
1117729934 14:58712249-58712271 TTCTTAACAAAGAGGTAGCAAGG - Intergenic
1119772359 14:77228190-77228212 CTTACAAGAAAGATGGAGAAAGG + Intronic
1119951619 14:78751470-78751492 CCTCCAAGAAATAGGGAGCAAGG - Intronic
1120191319 14:81442598-81442620 TTTTCATCAAAGAAAGAGCAGGG - Intergenic
1120437212 14:84496084-84496106 CTTTCAAGAAAAAAAGAGCATGG - Intergenic
1123474698 15:20581655-20581677 CTTTCTTCAAAGGAGGAGCAGGG - Intergenic
1123643313 15:22418702-22418724 CTTTCTTCAAAGGAGGAGCAGGG + Intergenic
1124035307 15:26048885-26048907 CTACCAACAATGAGGCAGCATGG - Intergenic
1125438854 15:39679180-39679202 CTTTTAAGAAAGATGGAGAATGG + Intronic
1127623994 15:60762442-60762464 CTTTCACCATAGATGGGGCAAGG - Intronic
1127927838 15:63564484-63564506 CTTTCAAGAATGAGGGATCTTGG - Intronic
1128143989 15:65322191-65322213 CTTGGAACGGAGAGGGAGCAGGG - Intergenic
1128914525 15:71547543-71547565 CTATCTACCAAGAGGGATCAGGG + Intronic
1131304443 15:91229170-91229192 CTTCCAACAGAAAGGGAACATGG + Intronic
1132781129 16:1626234-1626256 CTAACAGCAAAGAGGAAGCACGG - Intronic
1133837732 16:9381589-9381611 CTAGCAACAAACTGGGAGCAGGG + Intergenic
1134013766 16:10874322-10874344 GTTTCAACAGAGAGGAAGCCTGG + Intergenic
1135489695 16:22898812-22898834 TTCTCATCATAGAGGGAGCAAGG - Intronic
1137849613 16:51726883-51726905 GTTTTAAAAAAGAGGAAGCATGG + Intergenic
1138235179 16:55376403-55376425 CTTTGAATAAAGTGGGGGCATGG + Intergenic
1138343482 16:56306128-56306150 CTTTCAACAAAGAGGGAGCAGGG - Intronic
1139019275 16:62726909-62726931 CGTTGAAAAAAGAAGGAGCAAGG - Intergenic
1139117316 16:63972148-63972170 CTTTGAACAGACAGAGAGCATGG - Intergenic
1146068185 17:29654553-29654575 CTTTCCACAATGAGTTAGCATGG + Intronic
1150902778 17:69299987-69300009 TTTTCCACAGACAGGGAGCAAGG + Intronic
1151181713 17:72333892-72333914 TTTTTAAAAAAGAGGGGGCAGGG + Intergenic
1153718931 18:7881600-7881622 CTCTGAAGAAAGAGAGAGCAGGG - Intronic
1157893661 18:51443111-51443133 GTTTCACCAAAGAGGGAGGAGGG + Intergenic
1157963807 18:52185459-52185481 CTTTCAACTAAGAGAGAGAGAGG - Intergenic
1163059839 19:14752619-14752641 CATTCAAGAATGAGGGAGCCAGG + Intronic
1163817333 19:19474933-19474955 CTTCCATCAAAGAGGGACAAGGG - Intronic
1165478210 19:36044791-36044813 TTTTCAACAAAGAGAGAGCAGGG - Intronic
1167999520 19:53433208-53433230 ATTTCAACAAAGACGGAGTGGGG + Intronic
925449867 2:3959973-3959995 CTTTCACCAGAGAGTGAGAACGG - Intergenic
929031214 2:37651589-37651611 CCTTCACCAAAGAGGCAGCATGG + Intronic
929734235 2:44528717-44528739 TCTTCAACAAAGAAGAAGCAAGG - Intronic
930057804 2:47265334-47265356 CTTTCAACAAAGACGGCGTTCGG - Intergenic
931734061 2:65177995-65178017 CTTCCAACAAAAACGGGGCAGGG + Intergenic
933103299 2:78287667-78287689 CTCTCAGCAAAGAGGGGACATGG - Intergenic
933530221 2:83500089-83500111 TCTTCAACAAAGAGAGTGCATGG - Intergenic
934865799 2:97809344-97809366 CTTCCAACAGAGATGGAGAAGGG - Intronic
937637318 2:124170709-124170731 CTTTCACCATAGAGGCAGCCAGG - Intronic
939463088 2:142522837-142522859 CTTTCACCAAAGTGGTAGTAGGG - Intergenic
940168762 2:150803899-150803921 CTCTCAGCAAAGAGGGGACATGG + Intergenic
941155720 2:161975737-161975759 ATTTGAACAAAGAAGGGGCAAGG + Intronic
941164959 2:162074374-162074396 TTTTTAGCTAAGAGGGAGCAGGG - Exonic
941813705 2:169779488-169779510 CCATCAACAAGGAGGGAGAAGGG + Intergenic
942068614 2:172295306-172295328 CTTTGACCAATGAGGAAGCAGGG + Intergenic
944061783 2:195577411-195577433 CATTCATGAAAGAAGGAGCAAGG + Intronic
944821262 2:203434082-203434104 CTTTGCACAATCAGGGAGCAAGG + Exonic
945899832 2:215525227-215525249 CTTATAACAAAGAGGGAAGAGGG + Intergenic
947066567 2:226233083-226233105 CTTTCAACAAGAAAGGAGCTAGG - Intergenic
947233754 2:227918891-227918913 CTTTCAAAAAATAAAGAGCAGGG + Intronic
947570980 2:231234206-231234228 CTTTCAAGAAAGAGGGAAGGTGG + Intronic
948982574 2:241501854-241501876 TTTTGAACAAAAAGGGAGAAAGG - Intronic
1168779160 20:473951-473973 CTGTCAACAAAGAGGAAGGGAGG + Intronic
1170499120 20:16956656-16956678 CTTCCAACAGTGAGGAAGCAAGG + Intergenic
1173847780 20:46198995-46199017 CTATCAACAGAGAGAAAGCACGG - Intronic
1173874463 20:46361471-46361493 CCTCCAACAAAGAGGGCGCATGG + Intronic
1175399767 20:58693432-58693454 CTTCCACCAGAGAGGGGGCAGGG - Intronic
1175829740 20:61956488-61956510 CATTGAACAAAGACTGAGCAGGG + Intronic
1176130258 20:63493806-63493828 CCTGCCACAAACAGGGAGCAGGG + Intronic
1177403182 21:20632667-20632689 TTTTAAAAAAAGAGGAAGCAAGG - Intergenic
1180241957 21:46514820-46514842 CTTTTAACAAACAAGGAGAAGGG - Intronic
1180587666 22:16907206-16907228 CTTACAACAGGGAGGGAGGAAGG + Intergenic
1180613665 22:17113775-17113797 CTTACAAAGAAGAGGCAGCAGGG + Exonic
1181508552 22:23378417-23378439 CATTAAACAAAGAGAGAGCGGGG - Intergenic
1181590116 22:23878959-23878981 ATTTCAAAAACGAGGAAGCAAGG + Intronic
1181650290 22:24255435-24255457 CTTTCAGCAGAAAGGGAGTAAGG + Intergenic
1182454845 22:30443768-30443790 CTTTAAAAATAGAGTGAGCAAGG - Intergenic
1182473269 22:30561513-30561535 CATTCAGCAAAGCGGGGGCAGGG + Intronic
1183306489 22:37085787-37085809 CTTACAGCCAAGAGGGCGCAGGG - Intronic
1184252942 22:43271206-43271228 CTATGAGCAAGGAGGGAGCAGGG - Intronic
952022742 3:29042259-29042281 ATGTCAGCAAAGATGGAGCAGGG - Intergenic
952203718 3:31158043-31158065 CTTCCAACAAGGTGAGAGCACGG + Intergenic
952420847 3:33130195-33130217 CTTTGCACAAAAAGGCAGCATGG + Intronic
952997428 3:38898339-38898361 CTTTCAAAAACCAGTGAGCATGG - Intronic
953983773 3:47426261-47426283 CTTTCAACACAGGGGCAGGAGGG - Intronic
954653354 3:52178650-52178672 CCCTCAACAAAGAGGGAGCATGG + Intergenic
955439466 3:58940179-58940201 CATTCAACAAAGACTGAGCCAGG + Intronic
955925401 3:63999427-63999449 CTTTCAAAAAAGAGGGGGTGGGG - Intronic
959129936 3:102342002-102342024 CCATCAACAAAGAAGTAGCAAGG - Intronic
964167464 3:153725741-153725763 TTTACAACAAAGAAGTAGCAGGG - Intergenic
966383768 3:179371509-179371531 CTTTCAAAAAAAAGGAAGAAAGG + Intronic
968253318 3:197243544-197243566 CTTTCAACTAATAGGGATGAAGG + Intronic
969270067 4:6093775-6093797 CTTTCCTCAAAGAAGGAGCCAGG + Intronic
969655776 4:8497670-8497692 CCTTGAACAAAGACAGAGCAGGG - Intergenic
970532042 4:16994764-16994786 CTTTCAACAAACATCTAGCAAGG - Intergenic
974243108 4:59277938-59277960 CTCTCAACAAAGAGGCATGAAGG + Intergenic
978241534 4:106522745-106522767 CTTTCAAAAAAGAGCTAACATGG - Intergenic
979032223 4:115664611-115664633 CTTTCATCACAGTGGGTGCAAGG - Intergenic
982094000 4:151904533-151904555 CTTTCTACAGAGAGATAGCAGGG + Intergenic
983331014 4:166329329-166329351 CTTACAAGATAGAGGAAGCAGGG + Intergenic
983707094 4:170675282-170675304 CTTTTCACAAAGAGGCAGGATGG + Intergenic
985973468 5:3395128-3395150 CTTAGAACAAACAGGGAGCTTGG + Intergenic
986573046 5:9184892-9184914 CCTTCAACAAAGAGGGAGCCTGG - Intronic
987520041 5:18970064-18970086 GTTTCAGCAAAGAGGGAAGATGG + Intergenic
987667518 5:20963818-20963840 CTTTAAATAAATAGGGGGCAAGG + Intergenic
988911529 5:35848220-35848242 TTTTCCACAAAGTGGGAGCAGGG + Intergenic
989807666 5:45630243-45630265 ATTTAAGCAGAGAGGGAGCAAGG + Intronic
991436988 5:66606742-66606764 CTTGCAACAGGGAGGGTGCATGG + Intronic
991446377 5:66704433-66704455 CTTTCAACAGAGATGAAGGATGG - Intronic
992021818 5:72632287-72632309 CTTTGACCAAAGAGGGCGAATGG - Intergenic
996043540 5:118843991-118844013 CTTTCATCAAGGAAGGAGCAAGG - Intronic
998914614 5:147000353-147000375 CTTTAAACAGAGAGGCAGTAGGG + Intronic
999551723 5:152694886-152694908 CTTTTAACAAAAATGGAGAAGGG - Intergenic
1000027292 5:157370513-157370535 TTTTTATCAAAGAGGGAGTAGGG - Intronic
1001751191 5:174132870-174132892 CCTTCCACCAAGAGGTAGCATGG - Intronic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1003289598 6:4768302-4768324 TTTTCAACAAAGAGGAACCAAGG + Intronic
1003898169 6:10627861-10627883 TATTCAACAGAGAGGGAGAAAGG + Exonic
1006745148 6:36336514-36336536 ATCTCTAAAAAGAGGGAGCAAGG - Intronic
1008745758 6:54667787-54667809 CTTTCAGCAGAGAGGGGACATGG - Intergenic
1013082705 6:106826346-106826368 CTACCTACAAAGAGTGAGCAGGG - Intergenic
1018642215 6:165915072-165915094 CTTTCAACAAATAGCATGCATGG + Intronic
1020500241 7:8909250-8909272 CATACCACAAAGAGGGAGGAGGG - Intergenic
1023092404 7:36629402-36629424 CATTCAACAGGGAGGGGGCAGGG + Intronic
1023166859 7:37351449-37351471 CTTTCCCCATGGAGGGAGCATGG - Intronic
1023220144 7:37913645-37913667 CTTTCAAGTAAGAGAGAGGAGGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024685638 7:51741962-51741984 CTTCCAACAACCAGGGAGCTTGG + Intergenic
1026459195 7:70598594-70598616 GTTTAAAAAAAGAGGGAGTAGGG + Intronic
1031037130 7:116799734-116799756 CTTTAAAGAAATAGGGAGAAGGG + Intergenic
1031246122 7:119313976-119313998 CTTTAAATGAAGAGGGAACATGG + Intergenic
1031402719 7:121344874-121344896 CTCTCACCAAAGAGTGAGTAGGG - Intergenic
1032060619 7:128721760-128721782 CTTTCAATAAATAGGAAGAAAGG - Intronic
1033166474 7:139042805-139042827 CTTTCAGTGGAGAGGGAGCAGGG - Intergenic
1037507250 8:19542958-19542980 CTATCAACAAGCAGAGAGCATGG + Intronic
1038157859 8:25007764-25007786 CTTCCAACACAGAGGGAACTTGG - Intergenic
1038429118 8:27485708-27485730 CTTTCAGCAGAGAGGGGACACGG + Intergenic
1040580095 8:48690593-48690615 CTTTCAGCAGAGAGAGCGCAGGG - Intergenic
1040975911 8:53194484-53194506 CTGGCAACGGAGAGGGAGCAGGG + Intergenic
1041360606 8:57049526-57049548 CTTTCAGCAAAGAGAGGACATGG - Intergenic
1041978841 8:63831913-63831935 CTTTCAGCAGAGAGGGGACATGG - Intergenic
1043302237 8:78748000-78748022 CTTTGAAGAGAGAGGGATCATGG + Intronic
1044100565 8:88131844-88131866 CTTTCAACAATGAGAGAAGAGGG - Intronic
1044245682 8:89942149-89942171 CTTACAACACAGAAGGAGCTAGG + Intronic
1044681538 8:94783438-94783460 TTTTCTAAAAAGAGGGAGCAGGG - Intronic
1047537820 8:125735325-125735347 CTTTCAGCACAGAGGGAACACGG - Intergenic
1050241325 9:3638690-3638712 GTTTGAACAAAGAGAGAGAAGGG + Intergenic
1050426440 9:5516851-5516873 CTTTCAACCTTGTGGGAGCAGGG + Intronic
1052454521 9:28678254-28678276 CTTTCAGCACAGATGGAGCCTGG - Intergenic
1056257410 9:84814130-84814152 CTTTCCAGAAATAGGTAGCAAGG + Intronic
1056272103 9:84956199-84956221 CTTTCAACCAAGATGGCGCTTGG - Intronic
1057588263 9:96348734-96348756 CTTTCAACCAAGAGCCAGCCTGG - Intronic
1059771702 9:117432776-117432798 CTTTTAACAAACAGGGACCTTGG - Intergenic
1060243104 9:121921707-121921729 AGTTAGACAAAGAGGGAGCAGGG + Intronic
1060907729 9:127322770-127322792 CTTTCCACAAAGAGGGAAGGTGG + Intronic
1061736682 9:132665550-132665572 CTCTGAGCAGAGAGGGAGCAAGG + Intronic
1062293209 9:135807177-135807199 CTTTCCACAATGAGAGAGAAAGG + Intergenic
1185674286 X:1836231-1836253 CATTGAACAAAGACGGAGCGGGG + Intergenic
1186363406 X:8866715-8866737 CTTTCCTCACAGAGGTAGCATGG + Intergenic
1188115230 X:26234095-26234117 TTTACAACAATGAGGGAGAATGG - Intergenic
1189480634 X:41389791-41389813 ATTTCAGCAAAGAGGGAGTCAGG + Intergenic
1189515713 X:41711855-41711877 CTTTCAGCAGAGAGGGGACACGG - Intronic
1191141403 X:57120022-57120044 CCTCCAACAGAGAGGGAGCCAGG - Exonic
1191143048 X:57135990-57136012 CCTCCAACAGAGAGGGAGCCAGG - Exonic
1191749618 X:64527779-64527801 TATACCACAAAGAGGGAGCAAGG - Intergenic
1192306448 X:69965240-69965262 CTTAGAGTAAAGAGGGAGCATGG + Intronic
1193767917 X:85554867-85554889 ATAACAACAAAGAGAGAGCAAGG - Intergenic
1194140826 X:90206998-90207020 GTTTCAAGATAGAGGGAACAGGG - Intergenic
1195512518 X:105733893-105733915 CTTTCAACAAAAAAGTAACAAGG - Intronic
1195710516 X:107769768-107769790 CTTTCACCAATGAGTGAGCCTGG - Intronic
1197809307 X:130427386-130427408 CTTGGAACACAGAGGCAGCATGG + Intergenic
1198607763 X:138361866-138361888 CTTTCAATAAAGAGGGGTCTAGG - Intergenic
1198692093 X:139295442-139295464 CTTTCAGCAAAAGGGGAGAATGG - Intergenic
1201458098 Y:14193378-14193400 CATTGAACAAAGAAGGAGAAAGG + Intergenic