ID: 1138343517

View in Genome Browser
Species Human (GRCh38)
Location 16:56306328-56306350
Sequence GAATCTGCAGAGTTTAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 165}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138343509_1138343517 12 Left 1138343509 16:56306293-56306315 CCACACTCTGGGAAATCCCCTTC 0: 1
1: 0
2: 2
3: 19
4: 216
Right 1138343517 16:56306328-56306350 GAATCTGCAGAGTTTAGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 165
1138343513_1138343517 -5 Left 1138343513 16:56306310-56306332 CCCTTCATCGTTGTGGCGGAATC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1138343517 16:56306328-56306350 GAATCTGCAGAGTTTAGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 165
1138343505_1138343517 30 Left 1138343505 16:56306275-56306297 CCTGGAATCTTCAGCGGCCCACA 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1138343517 16:56306328-56306350 GAATCTGCAGAGTTTAGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 165
1138343512_1138343517 -4 Left 1138343512 16:56306309-56306331 CCCCTTCATCGTTGTGGCGGAAT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1138343517 16:56306328-56306350 GAATCTGCAGAGTTTAGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 165
1138343514_1138343517 -6 Left 1138343514 16:56306311-56306333 CCTTCATCGTTGTGGCGGAATCT 0: 1
1: 0
2: 1
3: 2
4: 46
Right 1138343517 16:56306328-56306350 GAATCTGCAGAGTTTAGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 165
1138343508_1138343517 13 Left 1138343508 16:56306292-56306314 CCCACACTCTGGGAAATCCCCTT 0: 1
1: 0
2: 0
3: 12
4: 161
Right 1138343517 16:56306328-56306350 GAATCTGCAGAGTTTAGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138343517 Original CRISPR GAATCTGCAGAGTTTAGGCA GGG Intronic
904313493 1:29644812-29644834 GACGCTGCAGAGTTTGGCCAAGG - Intergenic
904895377 1:33813570-33813592 GTAGCTGCAGAGCTCAGGCATGG - Intronic
905557306 1:38897393-38897415 GATTCTTCAAAGTTTAGGCCGGG - Intronic
908046295 1:60173066-60173088 GCATCTGCATTGTTTGGGCATGG - Intergenic
908675678 1:66600772-66600794 AAATGTGCTGATTTTAGGCAGGG + Intronic
908977353 1:69914178-69914200 GATTCTGCAAATTTTTGGCATGG - Intronic
911185176 1:94896145-94896167 GACTCTTCAAAGTTTAGGGAAGG - Intergenic
912549436 1:110475504-110475526 GAAGCTGCAGAGATGAGGCTGGG + Intergenic
915680045 1:157572602-157572624 GAAGGTGCAGAGTTTATGGAAGG + Intergenic
924426013 1:243951065-243951087 GAATTTGGAGAGTATAGGCTGGG + Intergenic
924449577 1:244165417-244165439 ACATCAGCAAAGTTTAGGCAGGG + Intergenic
1065385987 10:25133686-25133708 GAAGCAGCAGTGTTTAAGCAAGG + Intergenic
1069252210 10:66282649-66282671 GAATGAGCAGAATTTAGACATGG - Intronic
1070836184 10:79448298-79448320 GAAGGTGCAGAGTTTGGGCGTGG - Intergenic
1072738814 10:97897145-97897167 GAACAGGCAGAGTATAGGCAGGG - Intronic
1079569251 11:21922157-21922179 GAATCTGCTGCATTTAGGCCAGG - Intergenic
1080992205 11:37550716-37550738 GACTCTGCAGATTTTTGCCAAGG + Intergenic
1083335374 11:61918732-61918754 GAATCTGGAGAGTGGAGGCGAGG + Intronic
1085796644 11:79547079-79547101 GAATCTGGAGATTGTAGGGATGG + Intergenic
1088117401 11:106328009-106328031 GATTAAGCAGAGTTAAGGCAGGG + Intergenic
1090428942 11:126629932-126629954 GAATCTGGAGAGTTTAATAAAGG - Intronic
1092284855 12:7122808-7122830 ACATCTGCAGAGATTGGGCAGGG + Intergenic
1094112284 12:26874404-26874426 GACTCTGAAGAGTATAAGCAGGG - Intergenic
1095512181 12:42964151-42964173 AAACTTGCAGAGTCTAGGCAGGG - Intergenic
1096162165 12:49387733-49387755 GAACCTGAAGAGATTAGGCCTGG + Intronic
1098549459 12:71747262-71747284 GAAGCTGCAGAGGCCAGGCATGG + Intergenic
1100281830 12:93125625-93125647 GAAGCTGCAGGCTGTAGGCAGGG + Intergenic
1101274961 12:103189571-103189593 AAATCTGCATAGTGTAGGCCTGG + Intergenic
1103201614 12:119092567-119092589 GAATCAACAGAGTTTTTGCATGG - Intronic
1106895028 13:34290738-34290760 GAACTGGGAGAGTTTAGGCATGG - Intergenic
1107637937 13:42411930-42411952 GAATCTGCAGAGTTGCTCCAGGG - Intergenic
1108571461 13:51755924-51755946 GAATCTGCTGACTTTGGCCATGG - Intronic
1110046802 13:70842029-70842051 GCAGCTGCAGTGCTTAGGCAAGG - Intergenic
1111064163 13:83069148-83069170 AAATCTGTAGAGTTTAGTAATGG + Intergenic
1112781167 13:102902920-102902942 GAATCAGCAGAGTTAAGCCATGG + Intergenic
1114398294 14:22386852-22386874 CCAGCTGCAGGGTTTAGGCACGG - Intergenic
1115030933 14:28792977-28792999 GAATTTGGAGAGTTTTGGTATGG + Exonic
1115853011 14:37602397-37602419 GAACCTGCAGTGTTGTGGCAAGG + Intronic
1116722639 14:48519382-48519404 GAATCTGTAGCGCTAAGGCAGGG - Intergenic
1118435251 14:65765323-65765345 GGATAGGCAGAGTTTAGGGAAGG + Intergenic
1119581060 14:75781657-75781679 AAAACTGAAGAGTTTAGGCCGGG + Intronic
1121295484 14:92817678-92817700 CAATGTGCAGAGTTAATGCATGG - Intronic
1124032518 15:26024339-26024361 GCATCTGCTGAGATGAGGCAAGG + Intergenic
1124194449 15:27608900-27608922 CAATCAGCAGAATTTGGGCAGGG - Intergenic
1128575714 15:68773393-68773415 GCCACTGCAGAGTTTTGGCAGGG + Intergenic
1129810573 15:78507007-78507029 GAACCCGAACAGTTTAGGCAGGG - Intergenic
1130018900 15:80210638-80210660 GATTCTGAAGTGTTCAGGCAAGG - Intergenic
1132385456 15:101397119-101397141 GAAACTCCAGGGTTTCGGCAGGG + Intronic
1132805261 16:1772283-1772305 GAATGTGCAGAGGATACGCATGG - Exonic
1133034496 16:3027347-3027369 GAATCTGCAGAGGACAGGGAAGG - Exonic
1134111446 16:11517760-11517782 GTATCTGCAGAGTGAAGGGACGG + Intronic
1134874427 16:17684328-17684350 GAAACTGGAGATTTTAGCCAAGG + Intergenic
1138343517 16:56306328-56306350 GAATCTGCAGAGTTTAGGCAGGG + Intronic
1140999123 16:80291212-80291234 TAATCGGCAGAGATTAGGCTGGG - Intergenic
1143989543 17:10944912-10944934 GAAGCTGCAGAGTTTTGGGGTGG - Intergenic
1147328058 17:39679466-39679488 GCTTCTTCAGAGTTCAGGCAGGG + Intronic
1149470320 17:56910968-56910990 TAAACAGCAGAGTTTAGGCCAGG + Intronic
1152571775 17:81124182-81124204 GAAGCAGCAGAGGTGAGGCAGGG + Intronic
1153724989 18:7945156-7945178 GAATCTGCAGAGTCCCGGCCGGG + Intronic
1156119741 18:33827848-33827870 AATTCTGCAGAGTTTAAGAAAGG - Intergenic
1162788819 19:13052666-13052688 GAATCGGCAGGGTTAAGGCCAGG - Intronic
1164600995 19:29563087-29563109 GAAGCTGTGCAGTTTAGGCAGGG + Intronic
1166863488 19:45822808-45822830 GAGTTTGATGAGTTTAGGCAGGG + Exonic
925704057 2:6667292-6667314 GAATCTCCAGGGTCTGGGCATGG + Intergenic
927997735 2:27497651-27497673 GAAACAGAAAAGTTTAGGCAGGG - Intronic
932048931 2:68380047-68380069 GGATATGGAGAGGTTAGGCAAGG + Intronic
933187767 2:79297972-79297994 GGTTCTCCAGAGTTTAGTCAAGG + Intronic
933797061 2:85928017-85928039 GAAACTGGAGAGTGAAGGCATGG + Intergenic
934676590 2:96253755-96253777 GGAGCTGCAGAGTTGAGGGAGGG + Exonic
935660359 2:105461446-105461468 AAAGATGCAGAGTTTGGGCATGG + Intergenic
939921565 2:148121290-148121312 GAATATGCATAATTTATGCATGG + Intronic
941589380 2:167400565-167400587 GTATCTTCAGGGTCTAGGCATGG - Intergenic
948298948 2:236887753-236887775 GAAAATGCAGAGTGAAGGCAGGG + Intergenic
1170021672 20:11843391-11843413 GAATCTGCAGTTTTAAGTCAGGG - Intergenic
1170163459 20:13339096-13339118 AAATCTGCTGAGTTTAGGACTGG + Intergenic
1170413264 20:16113164-16113186 CAATCTGCACAGTTTTGACAAGG - Intergenic
1171213507 20:23335045-23335067 AAACCTGCAGAGTTGAAGCAAGG - Intergenic
1171512082 20:25694384-25694406 GAATCTGCACAGATTAGGAGGGG + Intronic
1172335626 20:34113046-34113068 GAATTTACAGGGTTTGGGCAGGG + Intergenic
1173726172 20:45299597-45299619 GAGTCTGAAGAGGTCAGGCATGG + Intronic
1174665264 20:52252061-52252083 GAATGGGGAGAGTTTAGGGATGG + Intergenic
1175400657 20:58698279-58698301 GGATCTGCAGAGGTGAGGCGTGG + Intronic
1175693797 20:61086004-61086026 GAAGCTGGAGGGTTTAAGCATGG - Intergenic
1175764310 20:61582189-61582211 GAAGCTGCAGAGGTCAGGCCTGG - Intronic
1177068756 21:16474292-16474314 GAAGCTGCAGCTTTTTGGCATGG - Intergenic
1180126131 21:45791407-45791429 GCAGCTCCAGAGTCTAGGCACGG + Intronic
1180669144 22:17539744-17539766 GAATCTGCTGTTTTTAAGCAGGG - Intronic
1183953318 22:41364654-41364676 GAACCTGCAGAGGCCAGGCACGG + Intergenic
1184536513 22:45091352-45091374 GGACCTGCAGAGCTCAGGCAGGG + Intergenic
1185072179 22:48662418-48662440 GAGTCTGCAGAGGTCAGGCTGGG + Intronic
949538277 3:5012418-5012440 GAAGCTGCAGACTTTTGGAAAGG + Intergenic
949694651 3:6680738-6680760 TAATCTGCTGAGTTGAGTCATGG - Intergenic
950886209 3:16365240-16365262 GAATCTGCAGGTTTTAGGGTGGG - Intronic
953168008 3:40482436-40482458 GAATCTGCAGAATCTAAGGAAGG - Intronic
953836937 3:46354550-46354572 GGATCTCCTGAGTTGAGGCAAGG - Intronic
955061198 3:55492750-55492772 GAATGTAAAGAGTTTAGACAGGG - Intergenic
956161132 3:66353709-66353731 GAATCTGCTGAGCTTGGGCAAGG + Intronic
956216751 3:66857428-66857450 AACTCTGCAAAGTTTAGCCACGG + Intergenic
956639021 3:71397137-71397159 GAACCAGCAGAGTCTAGGCAGGG + Intronic
956692838 3:71893730-71893752 GCCTCTGCTGGGTTTAGGCAAGG + Intergenic
957644552 3:82903684-82903706 GAATCTTAAAAGTTTAGGCCAGG - Intergenic
958448259 3:94241327-94241349 GAGACTGCAGAATCTAGGCAGGG - Intergenic
959239236 3:103767395-103767417 GAATCTGCTGATTGTAGACATGG + Intergenic
962382802 3:134911019-134911041 GACTATGCAGAGTTCAGGAATGG + Intronic
962441676 3:135425016-135425038 GAATCTTCAAAGTTTTGGTATGG - Intergenic
963371745 3:144409927-144409949 GAAACTGCAAAGTTTCTGCACGG - Intergenic
963821513 3:149899930-149899952 GAATCTGGAGAGTTTGGGGCTGG + Intronic
964202398 3:154132652-154132674 GAAGCTGCAGCGTTTAGGGCAGG + Intronic
967700963 3:192591812-192591834 GAATCTGAAGACTTTGGGGAAGG + Intronic
969257577 4:6012912-6012934 GGATATGTAGAGCTTAGGCATGG - Intergenic
972458687 4:39279188-39279210 GAATATCCTGAGTTTTGGCACGG - Intronic
981786842 4:148488996-148489018 GAATCTGGAGAGTTGAGTGATGG + Intergenic
982175193 4:152699756-152699778 GATTCTGCAGTGTTAAGCCAGGG + Intronic
982722988 4:158878304-158878326 GAAGCTCCAGACTTTAGGTAAGG - Intronic
983920687 4:173341066-173341088 CATTCTGTAGATTTTAGGCATGG + Intergenic
987468677 5:18303868-18303890 GACTCTGCAGTTTGTAGGCAGGG + Intergenic
987927842 5:24364947-24364969 GTGGCTGCAGTGTTTAGGCAGGG - Intergenic
989718884 5:44501012-44501034 GAAGCTGCAGAGATAAGACATGG + Intergenic
990881386 5:60542938-60542960 GAATCTGCAGACTTTTGGATGGG + Intergenic
992089656 5:73305665-73305687 TAAGCTGCAGAATTTAAGCAAGG + Intergenic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
993515832 5:88833902-88833924 GTAACTACAGAGTTTTGGCAAGG - Intronic
993658550 5:90602160-90602182 AAATCTGCAGAATTTGGGAATGG - Intronic
999032541 5:148309773-148309795 GAAACTGCTGAGTTCAGTCAAGG - Intergenic
999284003 5:150383178-150383200 GCATCTGCAGAGAGAAGGCATGG - Intronic
999983470 5:156980104-156980126 GAATATGCTGAGTTTATGGATGG - Intergenic
1000259602 5:159574946-159574968 GAATCAGGAGAGTAGAGGCATGG - Intergenic
1000732952 5:164859164-164859186 GAATTTGTAGAGTTGAGGGATGG - Intergenic
1003749069 6:9036031-9036053 GAATTTGCAGAGTGTAGTGATGG - Intergenic
1005656986 6:27949493-27949515 GTATATGTAGAGTTCAGGCAGGG - Intergenic
1006331252 6:33392517-33392539 GAATCTGCACAATTTGGGAAAGG - Intronic
1007104603 6:39274838-39274860 GAACCTGCAGAGATGAGGAAAGG - Intergenic
1007560750 6:42806319-42806341 GAATCTCCAGGGTTGGGGCAGGG + Intronic
1009547658 6:65042044-65042066 GAATCTGCATATTGTATGCATGG + Intronic
1009618334 6:66039207-66039229 GAATCAGCTGAGTTTAGCCTGGG - Intergenic
1011191429 6:84733598-84733620 GACACTGCAGAGTTTAGTTAGGG + Exonic
1013164934 6:107581204-107581226 GAGGGTGCAGAGCTTAGGCAAGG + Intronic
1013170880 6:107635283-107635305 GCATCCGCAGAGCATAGGCATGG - Exonic
1013367716 6:109447856-109447878 CAAGGTGGAGAGTTTAGGCAGGG - Exonic
1013872779 6:114787343-114787365 TACTCTGCAGATTTTAGACATGG - Intergenic
1014181540 6:118389783-118389805 GAAGCTGAAGAATTTAGGGAGGG + Intergenic
1018861212 6:167712203-167712225 GAATAAGCAGAGGTTAAGCAAGG + Intergenic
1021201113 7:17729461-17729483 AAATCTCCAGTGTTTTGGCAGGG - Intergenic
1021360570 7:19707842-19707864 GAATCTGCAGATTCTAGACATGG + Intronic
1024377347 7:48654737-48654759 GAAACTTATGAGTTTAGGCAAGG + Intergenic
1024548754 7:50543091-50543113 CAATGTGCAGAGTCCAGGCAGGG - Intronic
1024743605 7:52382469-52382491 GAATTTGAAGAGTTAAGGGAGGG - Intergenic
1027486920 7:78773045-78773067 GAATGTGCAAAATGTAGGCAAGG + Intronic
1028108946 7:86915602-86915624 GAAAATTCAGAGTTTAGGCTTGG - Intronic
1029797826 7:102913811-102913833 TGATATGCAGAGTTTAAGCATGG + Intronic
1030802610 7:113870916-113870938 GAATATGCAGTGTTTAATCAAGG - Intergenic
1031050517 7:116940266-116940288 GGATCTGCACAGTTTAAGCCTGG - Intergenic
1031150421 7:118047688-118047710 GCATCTGCTGAGTTTCTGCATGG + Intergenic
1036663615 8:10725015-10725037 GAATATGCACAGTCTAGGCCGGG - Intergenic
1041439004 8:57873981-57874003 GACTCTGCCGTGTTAAGGCATGG - Intergenic
1042638739 8:70908923-70908945 GAGTCTCCAGAGTTAAGGCAAGG - Intergenic
1042839149 8:73106299-73106321 GAGACTGCAGAGTTAAGGGAAGG - Intronic
1044016024 8:87049682-87049704 GAAAGTGCAGGGTTTAGGCAAGG + Intronic
1047021943 8:120784874-120784896 GAGTCTGCAGAGTTTAAGGAGGG + Intronic
1048777834 8:137967214-137967236 GAATGTGCAAAGATGAGGCAAGG - Intergenic
1048854499 8:138674686-138674708 GAATCTGCAGGGAGTAGACAGGG + Intronic
1048942803 8:139416809-139416831 GAAGCCTCAGAGTTTAGGCCGGG + Intergenic
1050924078 9:11241372-11241394 CAACCCACAGAGTTTAGGCAGGG + Intergenic
1052101547 9:24452510-24452532 GAAAATGCAGATATTAGGCATGG + Intergenic
1052284567 9:26770343-26770365 GGATCTCCAGAGTTAAGGGATGG + Intergenic
1059769978 9:117415295-117415317 GAATTTGGGGAGTTTAGGGAGGG - Intergenic
1188533211 X:31164981-31165003 GAATCTGAAGAGGTTAGGAATGG - Intronic
1190622395 X:52300349-52300371 GAATCTGCACTGCTTAGGGAGGG + Intergenic
1192220720 X:69195724-69195746 GATTCTGCAGAGTAAAGGCCAGG + Intergenic
1198406975 X:136322850-136322872 GAATCGGCTGAGTTCAGGAATGG - Exonic
1199100712 X:143796502-143796524 GAATGTTCTGAGTTTGGGCAAGG + Intergenic
1199239595 X:145530668-145530690 AAATCTGCAGGCTTGAGGCAGGG - Intergenic
1199739510 X:150720198-150720220 GAATGTGAAGAGTTTTGACACGG + Intronic
1199885725 X:152020192-152020214 GAAGCAAGAGAGTTTAGGCAAGG + Intergenic
1200316026 X:155134181-155134203 AAAGCTGCAGAGTTTGGGCAGGG + Intronic