ID: 1138345699

View in Genome Browser
Species Human (GRCh38)
Location 16:56318875-56318897
Sequence CTGTTTGTGCAGATAAAACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138345699_1138345703 -9 Left 1138345699 16:56318875-56318897 CCCCGTTTTATCTGCACAAACAG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 1138345703 16:56318889-56318911 CACAAACAGCCCTGTGCAGTGGG 0: 2
1: 0
2: 2
3: 23
4: 267
1138345699_1138345707 11 Left 1138345699 16:56318875-56318897 CCCCGTTTTATCTGCACAAACAG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 1138345707 16:56318909-56318931 GGGGAGTAGTGAGAGAACAGAGG 0: 1
1: 0
2: 3
3: 30
4: 413
1138345699_1138345702 -10 Left 1138345699 16:56318875-56318897 CCCCGTTTTATCTGCACAAACAG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 1138345702 16:56318888-56318910 GCACAAACAGCCCTGTGCAGTGG 0: 2
1: 0
2: 3
3: 29
4: 332
1138345699_1138345708 19 Left 1138345699 16:56318875-56318897 CCCCGTTTTATCTGCACAAACAG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 1138345708 16:56318917-56318939 GTGAGAGAACAGAGGCTCAGAGG 0: 1
1: 2
2: 21
3: 158
4: 947
1138345699_1138345704 -8 Left 1138345699 16:56318875-56318897 CCCCGTTTTATCTGCACAAACAG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 1138345704 16:56318890-56318912 ACAAACAGCCCTGTGCAGTGGGG 0: 1
1: 1
2: 2
3: 29
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138345699 Original CRISPR CTGTTTGTGCAGATAAAACG GGG (reversed) Intronic
902683596 1:18060943-18060965 CAGTTTGTTCAGCTAAAAAGAGG + Intergenic
905880684 1:41461416-41461438 CTGTTTTTGCAAGTAAAACCTGG - Intergenic
907839625 1:58143899-58143921 CTGTTTGTGCAGTTAAAATCTGG - Intronic
909757905 1:79250167-79250189 CTTGTTGTGCAGATAAAGTGAGG + Intergenic
911292844 1:96079182-96079204 CTCTTTGTGCATCTAAAAGGAGG - Intergenic
911496047 1:98632628-98632650 GTGTTTGTGCAGAGAGAAGGAGG + Intergenic
914349355 1:146826919-146826941 CTGTTTGTGGAGATACCACATGG + Intergenic
917415658 1:174806704-174806726 CTGTTTATGAAAATAAAACATGG - Intronic
922421824 1:225465629-225465651 CTGTCTGTGCACAAGAAACGAGG + Intergenic
923292829 1:232563321-232563343 CTGTGTGTTCAGACAAAATGAGG - Intergenic
1064393561 10:14961435-14961457 CTGTTTGTGGAGCTACAACTTGG + Intronic
1065668389 10:28087205-28087227 CTGTGTGTGCAGAGATCACGTGG - Intronic
1066539053 10:36424523-36424545 CTGTTTCTGCAAATGAAATGTGG - Intergenic
1066540961 10:36446315-36446337 GTATTGGTGGAGATAAAACGTGG + Intergenic
1067135655 10:43605463-43605485 CTGTTTGCGCAGATTAATCAGGG - Intergenic
1071393885 10:85202475-85202497 CTTATTGTGCAGATAAAATTAGG + Intergenic
1072817999 10:98528548-98528570 CGGTGTGTGCAGATCAAACCAGG + Intronic
1074734824 10:116419188-116419210 CTGTTTTTGCACATGAAACTAGG + Intergenic
1075102394 10:119515672-119515694 CTGTGTGTGCAGATAGCACAAGG - Intronic
1080227512 11:29976486-29976508 GTTTTTGTACAGATAAAATGGGG - Intergenic
1081423012 11:42894432-42894454 CTGATGGAGCAGATAAAATGAGG - Intergenic
1085524351 11:77155598-77155620 CTGTTTGTGAAGATTAAAGGAGG - Intronic
1086267818 11:85022601-85022623 CTTTTTTTACAGACAAAACGTGG - Intronic
1088437619 11:109832729-109832751 TTCTTTGTGCAGTTAAAATGAGG + Intergenic
1099846958 12:88039336-88039358 ATGTTTGTGCTTATAAAACAGGG + Intronic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1114152862 14:20064333-20064355 CTGCTTGTGCAGATAACTCCTGG + Intergenic
1114775845 14:25480377-25480399 CTTTTTGTGAAGATTAAACTTGG + Intergenic
1116535603 14:46025096-46025118 ATGTTTGTACACATAAAATGTGG + Intergenic
1121329876 14:93043282-93043304 CTGTCTGTGCACATAAACTGGGG - Intronic
1121700853 14:95953106-95953128 CTGTTTGTGCAGAGAAGCCTGGG - Intergenic
1127649574 15:60994095-60994117 CTGTTTGTCCAGTTCAAACTTGG - Intronic
1129365921 15:75054594-75054616 ATGCTTGTGCAGAAAAAATGGGG + Intronic
1131647078 15:94356257-94356279 ATGTTTGTCCAGTTAAAACTGGG + Exonic
1134037919 16:11045864-11045886 GTGTTTGTTGAGATAAAATGAGG + Intronic
1135775415 16:25253674-25253696 CTATTTGTGCAGATTAAATGCGG - Intronic
1137413468 16:48249451-48249473 CTGTTTGTATATATAAAACCTGG + Intronic
1137601548 16:49759824-49759846 CTGTCTGTGCAGATGAGACTAGG + Intronic
1137775893 16:51054057-51054079 CTGTCTGCACAGATAAAACTTGG + Intergenic
1138345699 16:56318875-56318897 CTGTTTGTGCAGATAAAACGGGG - Intronic
1138625797 16:58250278-58250300 CTGTTGGTGGAGCTAGAACGGGG + Intronic
1139984680 16:70888635-70888657 CTGTTTGTGGAGATACCACATGG - Intronic
1140479512 16:75254818-75254840 CTGTTTGTACAGAAAACAGGTGG + Intronic
1141355581 16:83343041-83343063 CTTTGTGTGCAGATATTACGAGG + Intronic
1143552991 17:7642695-7642717 CTGTTTGTAAAGATGAAACCTGG - Intergenic
1143782170 17:9234602-9234624 CTGTCAGTGCAGACAAAACCAGG - Intronic
1149279690 17:55089071-55089093 CTGTTTTTGCATATAAAAAGTGG + Intronic
1151287622 17:73124423-73124445 CTGTTGGTGAAGATAGAAGGAGG - Intergenic
1154014185 18:10601879-10601901 CTGTTTGTACAGAAAAAAAAAGG - Intergenic
1155868156 18:30992349-30992371 CTGGTTGTGCAGAACAAACAAGG - Exonic
1160357977 18:78244751-78244773 CTTTTTTTGCAGGGAAAACGGGG + Intergenic
1160999947 19:1905540-1905562 CCGTTTGTGGGGAGAAAACGGGG + Intronic
1164367837 19:27606214-27606236 CTGTTTTTGTAGAACAAACGTGG + Intergenic
925600896 2:5607818-5607840 CTGTTGGGGCAGATAAAAAGTGG - Intergenic
925616288 2:5747288-5747310 CTGTTCTTGCAGATAAAAAAGGG + Intergenic
928592899 2:32835370-32835392 CTGTGTGTGAAGAGAACACGTGG - Intergenic
928630356 2:33185284-33185306 ATGTTTGAGTAGATAAAATGAGG + Intronic
929326412 2:40616748-40616770 CTGTTTGGGGAGATAAGAGGGGG - Intergenic
931755597 2:65371362-65371384 CTGTTTGAACAGATTAAACTGGG + Intronic
933155433 2:78967924-78967946 CTTCTTGTGCAGATCAAACATGG + Intergenic
936465470 2:112744848-112744870 CTGTTTGCACATATAAAAGGTGG - Intronic
939004199 2:136766363-136766385 CTGTTTGTGGAGAGGAAACTGGG + Intronic
940493513 2:154394770-154394792 GTGTTTGGGCAGAAAAAACAAGG - Intronic
940770670 2:157836482-157836504 CTTTGTGTGCAGATATAAGGTGG - Intronic
941398338 2:164999389-164999411 CTGTATTTGCAGATATAACGTGG - Intergenic
941624229 2:167812820-167812842 CTGTTTCTGCTGATCAAACAGGG - Intergenic
944910818 2:204309001-204309023 TTGTTTGTGAAAATAAAATGAGG - Intergenic
946037563 2:216756016-216756038 GTGGTTGTACAGATAAAATGAGG + Intergenic
946394750 2:219437603-219437625 CTGATTGTGTAGATAGAAGGTGG + Intronic
947461734 2:230309600-230309622 CTTATTCTGCAGATAAAACCAGG - Intronic
948215849 2:236230110-236230132 CTGTTTGAGAAGATAAAAAGGGG + Intronic
948248875 2:236508919-236508941 CTGTTTGTTCAAATATAATGTGG - Intergenic
948300223 2:236900504-236900526 CTGTTTGTGCTGATTAAATGGGG + Intergenic
1175749965 20:61489252-61489274 CTGTTTGAGCAGATAGAACCAGG + Intronic
1176229854 20:64026838-64026860 CTGTTTGTGTACACAAAAGGTGG - Intronic
1179091831 21:38272884-38272906 CTGTTTATGCAGATAAATTGAGG - Intronic
1179823621 21:43951766-43951788 CTATGTGTGCAGAGAAAACCAGG + Intronic
1182445861 22:30388951-30388973 GTGTTTGTGGAGATACAAGGAGG + Intronic
1185224052 22:49643143-49643165 CTGTTTGGGTAGGGAAAACGAGG - Intronic
950852009 3:16070859-16070881 CTGTTTGAGCAGCTACAAAGAGG + Intergenic
951346518 3:21553042-21553064 CTGTTTTTGAAGATGAAATGGGG + Intronic
952059252 3:29487676-29487698 CTTTTTGTGAAGGTAAAATGGGG - Intronic
954280353 3:49572868-49572890 CTGTGTGTGCAGAAGAAAGGAGG + Intronic
954710744 3:52504028-52504050 CTGTGTGTGCAGGGAAAGCGAGG + Exonic
955661925 3:61308945-61308967 CTGTTTGTACAGGAAAAACTGGG - Intergenic
957146775 3:76434769-76434791 CTGTTTGCGCAGATTAATCAGGG + Intronic
957768741 3:84660123-84660145 CTGTATGTGCTGACAAAACCAGG - Intergenic
958616570 3:96500565-96500587 CTGTTTCTTCAGATGATACGTGG - Intergenic
962946641 3:140176961-140176983 CTGCTTGGGCAGAGAAAAGGGGG + Intronic
967061880 3:185879962-185879984 CTGTGTGTCCAGATAAGAAGGGG + Intergenic
973892550 4:55381880-55381902 CTATTTGTGCAGATGATGCGGGG - Intergenic
974060804 4:57033301-57033323 TTGTTTTTGCAGGTAAAAAGGGG - Exonic
976491628 4:85677306-85677328 CTGAATGTGCATATAAAATGTGG - Intronic
976622686 4:87144980-87145002 CTCCTTGTGCAGGTAAAACTTGG + Intergenic
978086716 4:104664196-104664218 CTATTTGTGCAGGCAAAAAGTGG + Intergenic
986948320 5:13050823-13050845 CAATTTTTGCAGATAAAAAGAGG + Intergenic
988702838 5:33692375-33692397 CTGATTGTGGAGATAAAACCTGG + Intronic
989301288 5:39896820-39896842 CTGTTTGAGCATATAAAACAAGG - Intergenic
989466254 5:41758934-41758956 CTGTGTGCCCAGATAAAACAGGG + Intronic
999334291 5:150701754-150701776 CTGGTTGTGGAGCTAAAAAGTGG + Intergenic
1001912829 5:175535049-175535071 CTTTTTGTGAAGATTAAAAGGGG + Intergenic
1007356783 6:41325668-41325690 CTGTTTGTCCAGAGATAAAGGGG - Intergenic
1008258750 6:49338802-49338824 ATTTTTGTGCAGATAAAGTGTGG + Intergenic
1008677070 6:53830491-53830513 CTGTTTGTGGAGCCAAAATGTGG + Intronic
1008860159 6:56139287-56139309 CTTTTTGTGAAGATTAAATGAGG - Intronic
1012898308 6:104977258-104977280 CTGTTTGTGCAAAGGAAAAGTGG - Intronic
1016012236 6:139149337-139149359 CACTTTCTGCAGATAAAACTTGG - Intronic
1016350981 6:143166922-143166944 TTGCTTGTTCAGATAAAATGTGG - Intronic
1016686278 6:146885904-146885926 AGGTTTGTGCAGACAAAACCAGG - Intergenic
1017183406 6:151575846-151575868 CTCTTTGTGGAGATAAAATGTGG + Intronic
1020245510 7:6426103-6426125 CTGCTTCTGCAGCTAAAAAGAGG + Exonic
1025857918 7:65300030-65300052 CTATTTATGCAGCTAAAACCCGG - Intergenic
1026412374 7:70137951-70137973 CTGTATGTGAACATAAAACAGGG + Intronic
1027987263 7:85309144-85309166 CTGTTAGTGCAGACAGAAAGAGG - Intergenic
1028620163 7:92816811-92816833 CTGTATGTCAAGATAAAAAGAGG + Intronic
1038418214 8:27413249-27413271 CTGTTTGGGGAGATAAACCCTGG - Intronic
1039124567 8:34186972-34186994 CTGAATGTGCAGATAAAAGATGG + Intergenic
1041311183 8:56518239-56518261 CTGTCTTTGCAGCTAAAACCAGG + Intergenic
1041504743 8:58583905-58583927 CTCTTAGGGCAGATAAAATGCGG - Exonic
1041742089 8:61166774-61166796 CTGTTTGCCCAGCTAAAACCTGG + Intronic
1042498580 8:69484310-69484332 CTGTTGATGCAGATAAGATGTGG - Intronic
1050896221 9:10887856-10887878 GTTTTTGGGCAGATAAAATGGGG - Intergenic
1051295452 9:15590361-15590383 GTTTTTGTGAAGATAAAATGAGG - Intronic
1052894202 9:33731969-33731991 CTGTTTGTGCAGATGAATTCAGG + Intergenic
1057442489 9:95092208-95092230 GTGTTTGTTGAGATAAAACAAGG + Intergenic
1058524242 9:105840932-105840954 CTGTTTCTGCAGGTAAATCATGG + Intergenic
1186789874 X:12986578-12986600 CTGTTTGCAGAGATAAGACGAGG - Intergenic
1188464986 X:30469856-30469878 CTGTTTCTGCACAGAAAATGAGG + Intergenic
1189775093 X:44463623-44463645 CTGGTGGTTTAGATAAAACGTGG + Intergenic
1190259204 X:48787453-48787475 CTGTTTGGGCAGACAGAATGTGG - Intronic
1191868705 X:65727157-65727179 ATGTTTGAGAAGATAAAACGGGG - Intronic
1192776707 X:74252999-74253021 TTGTTTGTGCAAATAAAAGTGGG + Intergenic
1192777354 X:74259143-74259165 CTGTTTGGGAAAATAAAACCAGG + Intergenic
1193521319 X:82532900-82532922 ATGTTTTTGCAGAGAAAGCGAGG - Intergenic
1193971519 X:88060906-88060928 GTGTTTGTGAAGATTAAATGAGG + Intergenic
1195291696 X:103436056-103436078 CTGATTGTGCAGATGAAATCTGG - Intergenic
1202193210 Y:22266301-22266323 CAGTGTGTCCAGATAAAAAGGGG + Intergenic